Incidental Mutation 'R0715:Zfp516'
ID62845
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R0715 (G1)
Quality Score117
Status Validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82987263 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 764 (Y764C)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably damaging
Transcript: ENSMUST00000071233
AA Change: Y764C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: Y764C

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171238
AA Change: Y764C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: Y764C

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Meta Mutation Damage Score 0.7063 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm11639 T C 11: 104,720,880 L516P possibly damaging Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mrm1 A G 11: 84,814,813 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phf3 A T 1: 30,811,838 L1145Q probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Sh3pxd2b A G 11: 32,423,341 E836G possibly damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Supt5 A T 7: 28,329,037 W178R probably damaging Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0426:Zfp516 UTSW 18 82955772 missense probably benign 0.04
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4378:Zfp516 UTSW 18 82987180 missense probably benign 0.00
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R4946:Zfp516 UTSW 18 82956094 missense probably benign 0.06
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6626:Zfp516 UTSW 18 82988107 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
R7073:Zfp516 UTSW 18 82988200 critical splice donor site probably null
R7463:Zfp516 UTSW 18 82957108 missense probably benign 0.08
R7863:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R7946:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R8097:Zfp516 UTSW 18 82987170 nonsense probably null
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Z1176:Zfp516 UTSW 18 82987533 missense probably benign 0.01
Z1177:Zfp516 UTSW 18 82956066 missense probably damaging 1.00
Z1177:Zfp516 UTSW 18 82956067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTTGCACAAGGAGCACTGC -3'
(R):5'- ACCAACACGGGTTATCACTGAGGG -3'

Sequencing Primer
(F):5'- CTGCGGGGTAGGAAAGC -3'
(R):5'- ATATCCATCGGGGCCAGAG -3'
Posted On2013-07-30