Incidental Mutation 'R7737:Tie1'
ID628457
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 118478857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably null
Transcript: ENSMUST00000047421
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184261
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
R7410:Tie1 UTSW 4 118479877 missense probably benign
R7486:Tie1 UTSW 4 118479904 critical splice acceptor site probably null
R7637:Tie1 UTSW 4 118472978 missense probably damaging 1.00
R7878:Tie1 UTSW 4 118478424 missense probably damaging 1.00
R8012:Tie1 UTSW 4 118486481 missense possibly damaging 0.77
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Z1176:Tie1 UTSW 4 118474177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAAGTTTGGACATCCTGG -3'
(R):5'- CTGGGCCTATATCCAAGTACATCG -3'

Sequencing Primer
(F):5'- GACATCCTGGTATCACACTATGGG -3'
(R):5'- TCCAAGTACATCGTGGAGATTCAG -3'
Posted On2020-04-20