Incidental Mutation 'R7737:Xpo5'
ID628462
Institutional Source Beutler Lab
Gene Symbol Xpo5
Ensembl Gene ENSMUSG00000067150
Gene Nameexportin 5
SynonymsExp5, 2700038C24Rik, 2410004H11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46202855-46242299 bp(+) (GRCm38)
Type of Mutationintron (89 bp from exon)
DNA Base Change (assembly) G to A at 46236090 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087031]
Predicted Effect probably null
Transcript: ENSMUST00000087031
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150

DomainStartEndE-ValueType
IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Xpo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Xpo5 APN 17 46225047 missense probably damaging 1.00
IGL00650:Xpo5 APN 17 46208246 missense probably damaging 1.00
IGL00785:Xpo5 APN 17 46204692 missense probably damaging 1.00
IGL01869:Xpo5 APN 17 46242207 missense possibly damaging 0.75
IGL01929:Xpo5 APN 17 46202929 missense probably benign 0.13
IGL02433:Xpo5 APN 17 46239520 missense probably damaging 0.99
IGL02550:Xpo5 APN 17 46229329 missense probably benign 0.16
IGL02637:Xpo5 APN 17 46235979 missense probably damaging 1.00
IGL02942:Xpo5 APN 17 46208133 missense probably damaging 0.99
IGL03004:Xpo5 APN 17 46207840 missense probably damaging 1.00
IGL03149:Xpo5 APN 17 46215814 splice site probably null
IGL03296:Xpo5 APN 17 46221394 nonsense probably null
fortify UTSW 17 46221421 missense probably benign 0.01
fortissimo UTSW 17 46235970 missense probably benign 0.36
PIT4403001:Xpo5 UTSW 17 46239569 missense probably benign 0.01
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0035:Xpo5 UTSW 17 46240175 missense probably benign
R0276:Xpo5 UTSW 17 46241507 missense probably damaging 1.00
R0626:Xpo5 UTSW 17 46221433 missense probably damaging 1.00
R0843:Xpo5 UTSW 17 46222650 splice site probably benign
R1440:Xpo5 UTSW 17 46207927 splice site probably benign
R1506:Xpo5 UTSW 17 46227888 missense probably benign 0.04
R1513:Xpo5 UTSW 17 46226980 missense probably benign 0.06
R2060:Xpo5 UTSW 17 46225091 missense probably damaging 1.00
R2258:Xpo5 UTSW 17 46240896 nonsense probably null
R2259:Xpo5 UTSW 17 46240896 nonsense probably null
R2260:Xpo5 UTSW 17 46240896 nonsense probably null
R2263:Xpo5 UTSW 17 46230343 missense probably benign
R3016:Xpo5 UTSW 17 46220831 missense probably damaging 1.00
R3149:Xpo5 UTSW 17 46242247 synonymous probably null
R3150:Xpo5 UTSW 17 46242247 synonymous probably null
R4613:Xpo5 UTSW 17 46236963 missense probably benign
R4784:Xpo5 UTSW 17 46222717 missense possibly damaging 0.59
R4808:Xpo5 UTSW 17 46235970 missense probably benign 0.36
R4981:Xpo5 UTSW 17 46220817 missense probably damaging 0.99
R5159:Xpo5 UTSW 17 46217609 missense probably damaging 1.00
R5286:Xpo5 UTSW 17 46234480 missense probably benign
R5294:Xpo5 UTSW 17 46236922 missense probably benign 0.12
R5550:Xpo5 UTSW 17 46234492 missense possibly damaging 0.87
R5750:Xpo5 UTSW 17 46218630 critical splice donor site probably null
R5774:Xpo5 UTSW 17 46241846 nonsense probably null
R5921:Xpo5 UTSW 17 46221421 missense probably benign 0.01
R6165:Xpo5 UTSW 17 46235957 missense possibly damaging 0.53
R6576:Xpo5 UTSW 17 46240808 splice site probably null
R7244:Xpo5 UTSW 17 46214625 missense probably damaging 1.00
R7414:Xpo5 UTSW 17 46221369 missense probably benign
R8144:Xpo5 UTSW 17 46208219 missense probably benign 0.09
X0019:Xpo5 UTSW 17 46234544 missense probably benign 0.00
X0062:Xpo5 UTSW 17 46230266 missense probably damaging 1.00
Z1176:Xpo5 UTSW 17 46220762 missense probably benign 0.11
Z1177:Xpo5 UTSW 17 46225124 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCAGCAAGATTTCTACACTGTGG -3'
(R):5'- TAGAGAGTTCCTGGCAAACAC -3'

Sequencing Primer
(F):5'- CAAGATTTCTACACTGTGGAGGACC -3'
(R):5'- GAGAGTTCCTGGCAAACACAAACC -3'
Posted On2020-04-20