Incidental Mutation 'R7587:Ncbp3'
ID 628482
Institutional Source Beutler Lab
Gene Symbol Ncbp3
Ensembl Gene ENSMUSG00000020783
Gene Name nuclear cap binding subunit 3
Synonyms 1200014J11Rik
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72937443-72974405 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 72957591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021135]
AlphaFold Q8BZR9
Predicted Effect probably null
Transcript: ENSMUST00000021135
SMART Domains Protein: ENSMUSP00000021135
Gene: ENSMUSG00000020783

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 33 52 N/A INTRINSIC
Pfam:DUF2414 123 177 4.5e-24 PFAM
low complexity region 191 231 N/A INTRINSIC
coiled coil region 345 364 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 602 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lpp A T 16: 24,581,029 (GRCm39) probably null Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Ncbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ncbp3 APN 11 72,964,355 (GRCm39) splice site probably benign
R0180:Ncbp3 UTSW 11 72,955,804 (GRCm39) splice site probably null
R0464:Ncbp3 UTSW 11 72,960,647 (GRCm39) splice site probably benign
R0620:Ncbp3 UTSW 11 72,940,671 (GRCm39) splice site probably benign
R2024:Ncbp3 UTSW 11 72,944,346 (GRCm39) missense possibly damaging 0.95
R2121:Ncbp3 UTSW 11 72,944,304 (GRCm39) missense possibly damaging 0.56
R4610:Ncbp3 UTSW 11 72,969,844 (GRCm39) missense probably damaging 0.98
R4693:Ncbp3 UTSW 11 72,966,503 (GRCm39) missense probably benign 0.00
R4883:Ncbp3 UTSW 11 72,960,578 (GRCm39) missense probably damaging 0.99
R4974:Ncbp3 UTSW 11 72,944,355 (GRCm39) critical splice donor site probably null
R5212:Ncbp3 UTSW 11 72,944,373 (GRCm39) intron probably benign
R5740:Ncbp3 UTSW 11 72,944,323 (GRCm39) missense possibly damaging 0.88
R5906:Ncbp3 UTSW 11 72,964,327 (GRCm39) missense probably benign 0.04
R6026:Ncbp3 UTSW 11 72,958,548 (GRCm39) missense probably benign 0.00
R6154:Ncbp3 UTSW 11 72,940,700 (GRCm39) missense probably damaging 1.00
R6403:Ncbp3 UTSW 11 72,969,802 (GRCm39) missense probably benign 0.00
R6626:Ncbp3 UTSW 11 72,964,210 (GRCm39) missense possibly damaging 0.88
R6838:Ncbp3 UTSW 11 72,964,300 (GRCm39) missense possibly damaging 0.89
R7155:Ncbp3 UTSW 11 72,938,835 (GRCm39) missense probably damaging 0.99
R7369:Ncbp3 UTSW 11 72,968,747 (GRCm39) missense probably benign 0.00
R7657:Ncbp3 UTSW 11 72,964,193 (GRCm39) missense probably damaging 1.00
R8774:Ncbp3 UTSW 11 72,938,808 (GRCm39) missense probably benign
R8774-TAIL:Ncbp3 UTSW 11 72,938,808 (GRCm39) missense probably benign
R9063:Ncbp3 UTSW 11 72,964,253 (GRCm39) missense probably damaging 1.00
R9478:Ncbp3 UTSW 11 72,968,768 (GRCm39) missense probably damaging 0.99
R9513:Ncbp3 UTSW 11 72,938,727 (GRCm39) start codon destroyed probably null 0.95
R9670:Ncbp3 UTSW 11 72,944,323 (GRCm39) missense possibly damaging 0.88
R9762:Ncbp3 UTSW 11 72,961,668 (GRCm39) missense probably benign 0.35
Y5379:Ncbp3 UTSW 11 72,964,086 (GRCm39) small deletion probably benign
Z1177:Ncbp3 UTSW 11 72,938,794 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGCCTCACCAGATGTTTC -3'
(R):5'- TTGCCTAACATGTGCAAGCCC -3'

Sequencing Primer
(F):5'- CTGAGGTAAACTATGATACTTGGGTC -3'
(R):5'- ATGAACACTCTCCAACATTTCTG -3'
Posted On 2020-04-21