Incidental Mutation 'R7587:Lpp'
ID 628483
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene Name LIM domain containing preferred translocation partner in lipoma
Synonyms B130055L10Rik, 9430020K16Rik
MMRRC Submission 045712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.179) question?
Stock # R7587 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 24212257-24811328 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 24581029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314]
AlphaFold Q8BFW7
Predicted Effect probably null
Transcript: ENSMUST00000038053
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078988
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115314
SMART Domains Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
LIM 291 344 1.03e-16 SMART
LIM 351 403 1.94e-12 SMART
LIM 411 472 2.5e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,585,736 (GRCm39) T131A probably damaging Het
Asah1 A T 8: 41,827,578 (GRCm39) V15D probably benign Het
Asic1 A C 15: 99,593,471 (GRCm39) Q276P probably damaging Het
Atl2 A T 17: 80,172,496 (GRCm39) V158E probably benign Het
Atrn T A 2: 130,822,034 (GRCm39) I909N probably damaging Het
BC034090 A G 1: 155,093,232 (GRCm39) V742A probably damaging Het
Capzb T A 4: 138,989,334 (GRCm39) D85E possibly damaging Het
Cdh20 T C 1: 104,869,004 (GRCm39) F165S probably damaging Het
Cfap44 A G 16: 44,224,469 (GRCm39) E59G probably benign Het
Clpsl2 G A 17: 28,768,515 (GRCm39) V10I probably benign Het
D630003M21Rik T A 2: 158,042,976 (GRCm39) S855C probably damaging Het
D630003M21Rik T C 2: 158,038,308 (GRCm39) Y1046C probably benign Het
D6Wsu163e A G 6: 126,932,859 (GRCm39) I361V probably benign Het
Dchs2 A G 3: 83,211,822 (GRCm39) I1874V probably benign Het
Dennd2a T G 6: 39,460,069 (GRCm39) K679Q probably damaging Het
Dio2 A G 12: 90,696,334 (GRCm39) V218A probably benign Het
Gpr107 A T 2: 31,058,838 (GRCm39) K109N probably benign Het
Gpr108 C T 17: 57,543,732 (GRCm39) R448Q probably damaging Het
Gucy2c A G 6: 136,681,288 (GRCm39) V932A probably damaging Het
Kcnj8 T C 6: 142,512,065 (GRCm39) T181A probably damaging Het
Kdm3b A G 18: 34,930,080 (GRCm39) probably null Het
Lipc A G 9: 70,726,206 (GRCm39) Y168H probably damaging Het
Lipi C T 16: 75,347,103 (GRCm39) V439M probably benign Het
Lrp1b T G 2: 40,620,729 (GRCm39) D3583A Het
Ltbr T C 6: 125,289,315 (GRCm39) T165A probably benign Het
Mroh3 A G 1: 136,118,736 (GRCm39) I527T probably benign Het
Mylk A G 16: 34,742,887 (GRCm39) E1133G probably benign Het
Nat3 T C 8: 68,000,226 (GRCm39) I35T probably damaging Het
Ncbp3 T C 11: 72,957,591 (GRCm39) probably null Het
Nedd1 G A 10: 92,534,592 (GRCm39) T306M probably benign Het
Nexn T C 3: 151,952,815 (GRCm39) R316G probably benign Het
Nox4 A G 7: 86,966,510 (GRCm39) H207R probably damaging Het
Nsun6 T C 2: 15,044,636 (GRCm39) Q110R probably benign Het
Or1e1b-ps1 C T 11: 73,846,010 (GRCm39) Q165* probably null Het
Or52n2c C T 7: 104,574,263 (GRCm39) R236H probably benign Het
Or7g32 T A 9: 19,408,818 (GRCm39) V258E probably damaging Het
Pappa2 T C 1: 158,678,701 (GRCm39) D905G probably damaging Het
Pepd T C 7: 34,668,965 (GRCm39) L195S probably damaging Het
Pms1 A G 1: 53,246,475 (GRCm39) S355P probably benign Het
Pop1 A T 15: 34,502,559 (GRCm39) K82M probably damaging Het
Ppp1r9b T A 11: 94,892,766 (GRCm39) D655E possibly damaging Het
Ppt2 A G 17: 34,845,777 (GRCm39) probably null Het
Pramel57 A G 5: 95,669,270 (GRCm39) T100A probably damaging Het
Prss35 T A 9: 86,637,427 (GRCm39) C66S probably damaging Het
Rfc3 A T 5: 151,574,616 (GRCm39) M1K probably null Het
Rffl T C 11: 82,700,974 (GRCm39) D284G probably damaging Het
Robo3 T C 9: 37,340,942 (GRCm39) D110G probably damaging Het
Rtel1 G A 2: 180,964,108 (GRCm39) V36M probably damaging Het
Slc1a7 T A 4: 107,867,683 (GRCm39) I457K possibly damaging Het
Smco1 A G 16: 32,092,541 (GRCm39) M71V probably benign Het
Snrnp200 G A 2: 127,069,822 (GRCm39) S989N probably damaging Het
Spef2 T A 15: 9,713,305 (GRCm39) I356F probably damaging Het
Stk24 C T 14: 121,539,699 (GRCm39) A166T probably damaging Het
Tada2b T C 5: 36,634,111 (GRCm39) I156V probably benign Het
Tasor2 T C 13: 3,618,849 (GRCm39) K2251E possibly damaging Het
Tbce C T 13: 14,194,327 (GRCm39) V111M probably damaging Het
Tlnrd1 A G 7: 83,532,155 (GRCm39) L92P probably damaging Het
Tnr T A 1: 159,713,778 (GRCm39) D735E probably benign Het
Tram1 T C 1: 13,649,771 (GRCm39) H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Unc5b C T 10: 60,618,899 (GRCm39) C81Y probably damaging Het
Vps13a G A 19: 16,681,153 (GRCm39) T1041M probably benign Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24,663,938 (GRCm39) missense probably damaging 1.00
IGL01354:Lpp APN 16 24,580,816 (GRCm39) nonsense probably null
IGL02141:Lpp APN 16 24,580,365 (GRCm39) missense probably damaging 0.98
IGL02182:Lpp APN 16 24,580,895 (GRCm39) missense probably damaging 0.99
IGL02230:Lpp APN 16 24,580,895 (GRCm39) missense probably damaging 0.99
IGL02232:Lpp APN 16 24,580,895 (GRCm39) missense probably damaging 0.99
IGL02234:Lpp APN 16 24,580,895 (GRCm39) missense probably damaging 0.99
IGL02236:Lpp APN 16 24,580,895 (GRCm39) missense probably damaging 0.99
IGL02371:Lpp APN 16 24,580,361 (GRCm39) missense probably damaging 0.96
IGL03265:Lpp APN 16 24,580,737 (GRCm39) missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24,580,697 (GRCm39) missense probably benign 0.23
R0047:Lpp UTSW 16 24,480,550 (GRCm39) splice site probably benign
R0047:Lpp UTSW 16 24,480,550 (GRCm39) splice site probably benign
R0092:Lpp UTSW 16 24,580,352 (GRCm39) missense probably benign 0.01
R0385:Lpp UTSW 16 24,580,587 (GRCm39) missense probably damaging 1.00
R0389:Lpp UTSW 16 24,426,991 (GRCm39) missense probably damaging 1.00
R0504:Lpp UTSW 16 24,790,720 (GRCm39) missense probably damaging 1.00
R0798:Lpp UTSW 16 24,790,622 (GRCm39) nonsense probably null
R1199:Lpp UTSW 16 24,500,610 (GRCm39) missense probably damaging 1.00
R1581:Lpp UTSW 16 24,500,591 (GRCm39) nonsense probably null
R1755:Lpp UTSW 16 24,663,874 (GRCm39) missense probably benign
R1848:Lpp UTSW 16 24,580,405 (GRCm39) missense probably damaging 1.00
R1980:Lpp UTSW 16 24,480,451 (GRCm39) missense probably damaging 1.00
R3432:Lpp UTSW 16 24,708,636 (GRCm39) missense probably benign 0.04
R3755:Lpp UTSW 16 24,663,911 (GRCm39) missense probably benign 0.00
R4078:Lpp UTSW 16 24,500,611 (GRCm39) missense probably damaging 1.00
R4214:Lpp UTSW 16 24,580,804 (GRCm39) nonsense probably null
R4712:Lpp UTSW 16 24,580,407 (GRCm39) missense possibly damaging 0.94
R4806:Lpp UTSW 16 24,480,430 (GRCm39) missense probably damaging 0.97
R4968:Lpp UTSW 16 24,798,064 (GRCm39) missense probably damaging 1.00
R5047:Lpp UTSW 16 24,790,596 (GRCm39) missense probably damaging 1.00
R5371:Lpp UTSW 16 24,708,554 (GRCm39) missense probably damaging 1.00
R5536:Lpp UTSW 16 24,663,956 (GRCm39) missense possibly damaging 0.54
R5875:Lpp UTSW 16 24,427,059 (GRCm39) missense probably benign 0.10
R7285:Lpp UTSW 16 24,796,029 (GRCm39) missense probably damaging 1.00
R7846:Lpp UTSW 16 24,426,876 (GRCm39) start codon destroyed probably null 0.98
R9065:Lpp UTSW 16 24,580,889 (GRCm39) missense probably benign 0.03
R9378:Lpp UTSW 16 24,540,737 (GRCm39) start codon destroyed probably benign 0.00
R9616:Lpp UTSW 16 24,580,719 (GRCm39) missense probably benign
Z1176:Lpp UTSW 16 24,580,353 (GRCm39) missense probably benign 0.00
Z1177:Lpp UTSW 16 24,480,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGCAGCAGGTCCTAGC -3'
(R):5'- GATTCCGCCCTTAGATCAGACTTTC -3'

Sequencing Primer
(F):5'- CTATGCAGCAGGTCCTAGCTATGG -3'
(R):5'- TGCACTGGATGCTGAAGA -3'
Posted On 2020-04-21