Incidental Mutation 'R7706:Uevld'
ID628486
Institutional Source Beutler Lab
Gene Symbol Uevld
Ensembl Gene ENSMUSG00000043262
Gene NameUEV and lactate/malate dehyrogenase domains
SynonymsAttp, 8430408E05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7706 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46923216-46958527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46948027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 72 (I72T)
Ref Sequence ENSEMBL: ENSMUSP00000147932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094398] [ENSMUST00000207986] [ENSMUST00000208308] [ENSMUST00000210227]
Predicted Effect silent
Transcript: ENSMUST00000094398
SMART Domains Protein: ENSMUSP00000091964
Gene: ENSMUSG00000043262

DomainStartEndE-ValueType
UBCc 18 171 3.36e-2 SMART
Pfam:Ldh_1_N 183 316 2.6e-19 PFAM
Pfam:Ldh_1_C 319 469 3.4e-13 PFAM
Predicted Effect silent
Transcript: ENSMUST00000207986
Predicted Effect probably benign
Transcript: ENSMUST00000208308
Predicted Effect possibly damaging
Transcript: ENSMUST00000210227
AA Change: I72T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Samm50 T A 15: 84,200,880 probably null Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Uevld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02858:Uevld APN 7 46955629 missense probably benign 0.31
IGL03294:Uevld APN 7 46931030 missense possibly damaging 0.84
R1344:Uevld UTSW 7 46938010 missense possibly damaging 0.93
R1418:Uevld UTSW 7 46938010 missense possibly damaging 0.93
R1698:Uevld UTSW 7 46955624 missense possibly damaging 0.92
R1848:Uevld UTSW 7 46945227 unclassified probably benign
R2872:Uevld UTSW 7 46947945 missense probably null 0.68
R2872:Uevld UTSW 7 46947945 missense probably null 0.68
R4426:Uevld UTSW 7 46940142 missense probably benign 0.15
R4664:Uevld UTSW 7 46937986 missense probably damaging 1.00
R5861:Uevld UTSW 7 46926356 missense probably benign 0.03
R6283:Uevld UTSW 7 46937981 missense possibly damaging 0.72
R7148:Uevld UTSW 7 46950976 missense probably damaging 0.99
R7718:Uevld UTSW 7 46938056 missense probably benign 0.03
R7727:Uevld UTSW 7 46943805 missense probably benign 0.13
R7775:Uevld UTSW 7 46926352 missense probably damaging 1.00
R7778:Uevld UTSW 7 46926352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCATTCACTGAATAAGCCC -3'
(R):5'- GCATGTGCTGTCCTTGCATAC -3'

Sequencing Primer
(F):5'- GCTTATGCATTGAATTCAAGTAGC -3'
(R):5'- AATTTGGTTCCCAGCACGAG -3'
Posted On2020-04-21