Incidental Mutation 'R7706:Samm50'
ID628488
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene NameSAMM50 sorting and assembly machinery component
Synonyms1110030L07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7706 (G1)
Quality Score198.009
Status Validated
Chromosome15
Chromosomal Location84192241-84217267 bp(+) (GRCm38)
Type of Mutationintron (163 bp from exon)
DNA Base Change (assembly) T to A at 84200880 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
Predicted Effect probably null
Transcript: ENSMUST00000023071
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik G A 17: 45,733,657 T46I unknown Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atxn7l2 T C 3: 108,207,403 D109G probably damaging Het
B4galnt3 C A 6: 120,218,952 V305L probably benign Het
C9 T A 15: 6,458,921 N85K probably benign Het
Cacna1g T C 11: 94,415,041 I1941V probably benign Het
Capn15 A G 17: 25,964,151 V518A probably benign Het
Chst10 A T 1: 38,866,025 Y200N probably damaging Het
Cir1 A G 2: 73,312,479 S4P probably damaging Het
Cish G A 9: 107,300,641 R172Q probably benign Het
Cnot10 A T 9: 114,593,438 N693K probably damaging Het
Ddx6 A G 9: 44,627,642 D249G probably damaging Het
Dennd6b T C 15: 89,185,244 D528G probably benign Het
Dmtf1 T A 5: 9,124,489 T484S possibly damaging Het
Dnaaf5 T C 5: 139,152,841 V259A probably damaging Het
Dzip1l A T 9: 99,637,536 S39C probably damaging Het
Efcab8 T A 2: 153,781,775 M60K Het
Eml2 T A 7: 19,186,110 V113D possibly damaging Het
Fnip1 A T 11: 54,515,499 I1141F probably benign Het
Gm7298 T A 6: 121,735,611 S127R probably damaging Het
Hcn2 G A 10: 79,734,183 R622Q possibly damaging Het
Ift172 C T 5: 31,266,379 W746* probably null Het
Irs1 A G 1: 82,287,691 Y935H probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl20 T C 1: 161,109,257 I183V probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lalba T C 15: 98,481,593 D103G probably damaging Het
Lpin3 T C 2: 160,905,290 L822P probably damaging Het
Lrrc38 G A 4: 143,350,275 C36Y probably damaging Het
Ly6e T C 15: 74,958,334 S46P possibly damaging Het
Narfl T C 17: 25,782,252 *493Q probably null Het
Nav2 T C 7: 49,594,319 I2098T probably benign Het
Nipbl T C 15: 8,351,526 E594G probably benign Het
Olfr552 T A 7: 102,604,646 H97Q probably benign Het
Parn T C 16: 13,607,253 D432G probably damaging Het
Pcdh20 A G 14: 88,467,357 S836P probably damaging Het
Pcmtd2 C T 2: 181,855,075 R282C probably damaging Het
Ppp2r3c A G 12: 55,281,705 I425T probably benign Het
Sars C T 3: 108,431,464 probably null Het
Senp8 A G 9: 59,737,838 Y12H possibly damaging Het
Slc13a4 T C 6: 35,270,355 I577V possibly damaging Het
Srr T G 11: 74,913,135 probably null Het
Steap2 T A 5: 5,682,967 N19I possibly damaging Het
Sucla2 A G 14: 73,568,993 Y168C probably damaging Het
Tha1 T C 11: 117,869,455 Q275R probably damaging Het
Trim56 T C 5: 137,114,656 N2S probably benign Het
Tubgcp6 T A 15: 89,104,223 H849L probably benign Het
Uevld A G 7: 46,948,027 I72T possibly damaging Het
Ybx1 A G 4: 119,278,967 *323Q probably null Het
Zfp354b C T 11: 50,928,563 probably null Het
Zfp36l2 A T 17: 84,186,918 L97Q probably benign Het
Zfp729a T A 13: 67,623,493 R78S possibly damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R1780:Samm50 UTSW 15 84211127 missense probably damaging 0.99
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4285:Samm50 UTSW 15 84197012 missense probably damaging 1.00
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6452:Samm50 UTSW 15 84204097 critical splice donor site probably benign
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
R7910:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
R7991:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGTGTCTGCAGAGTACAGTG -3'
(R):5'- AGGCTGCAGGTTGTATGTCC -3'

Sequencing Primer
(F):5'- CAGTGTGAGTATAGCAGGCCCTG -3'
(R):5'- AGGTTGTATGTCCCTCCCCAG -3'
Posted On2020-04-21