Incidental Mutation 'R7726:Scap'
ID628489
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene NameSREBF chaperone
Synonyms
Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110333288-110384950 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 110378367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098350]
Predicted Effect probably null
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110376631 missense probably damaging 1.00
IGL01012:Scap APN 9 110362420 missense probably damaging 1.00
IGL01487:Scap APN 9 110377734 critical splice donor site probably null
IGL01634:Scap APN 9 110378789 critical splice donor site probably null
IGL01725:Scap APN 9 110381554 unclassified probably benign
IGL01939:Scap APN 9 110379481 missense probably benign 0.02
IGL02106:Scap APN 9 110381656 unclassified probably benign
IGL02423:Scap APN 9 110378617 missense probably benign 0.02
IGL02487:Scap APN 9 110378690 missense probably benign 0.19
IGL02545:Scap APN 9 110378690 missense probably benign 0.19
IGL03226:Scap APN 9 110384267 missense possibly damaging 0.93
IGL03331:Scap APN 9 110380236 unclassified probably null
3-1:Scap UTSW 9 110372968 intron probably benign
R0027:Scap UTSW 9 110379730 missense probably benign 0.06
R0089:Scap UTSW 9 110372222 missense possibly damaging 0.81
R0742:Scap UTSW 9 110381259 missense probably damaging 1.00
R1416:Scap UTSW 9 110384773 missense probably damaging 1.00
R1785:Scap UTSW 9 110374055 missense probably damaging 0.97
R1996:Scap UTSW 9 110372971 intron probably benign
R2114:Scap UTSW 9 110381273 missense probably damaging 0.99
R2189:Scap UTSW 9 110377693 missense probably damaging 1.00
R2233:Scap UTSW 9 110381593 missense probably damaging 0.98
R2234:Scap UTSW 9 110381593 missense probably damaging 0.98
R2656:Scap UTSW 9 110374019 missense probably damaging 1.00
R3176:Scap UTSW 9 110374025 missense probably benign
R3237:Scap UTSW 9 110379582 missense probably damaging 0.96
R3276:Scap UTSW 9 110374025 missense probably benign
R3623:Scap UTSW 9 110380203 missense probably damaging 0.99
R3826:Scap UTSW 9 110381297 missense probably benign
R4859:Scap UTSW 9 110374342 unclassified probably benign
R4993:Scap UTSW 9 110378390 missense probably damaging 1.00
R5052:Scap UTSW 9 110353152 missense possibly damaging 0.89
R5330:Scap UTSW 9 110381633 missense probably benign 0.00
R5331:Scap UTSW 9 110381633 missense probably benign 0.00
R5383:Scap UTSW 9 110374529 missense probably damaging 0.99
R5410:Scap UTSW 9 110374182 unclassified probably null
R5531:Scap UTSW 9 110381429 missense possibly damaging 0.59
R5567:Scap UTSW 9 110377644 missense probably damaging 1.00
R5636:Scap UTSW 9 110380594 missense probably damaging 0.99
R5637:Scap UTSW 9 110381572 missense possibly damaging 0.94
R5859:Scap UTSW 9 110374047 missense probably benign 0.14
R5923:Scap UTSW 9 110383580 missense probably damaging 0.98
R5945:Scap UTSW 9 110384596 missense probably benign 0.00
R5987:Scap UTSW 9 110381151 missense probably damaging 1.00
R6075:Scap UTSW 9 110378777 missense probably damaging 1.00
R6130:Scap UTSW 9 110380379 missense possibly damaging 0.95
R6190:Scap UTSW 9 110374067 missense probably benign 0.01
R6567:Scap UTSW 9 110383562 missense probably damaging 1.00
R6999:Scap UTSW 9 110384647 missense probably damaging 1.00
R7098:Scap UTSW 9 110372242 missense possibly damaging 0.89
R7386:Scap UTSW 9 110373169 missense probably benign 0.00
R7642:Scap UTSW 9 110374013 missense probably damaging 1.00
R7898:Scap UTSW 9 110384743 missense possibly damaging 0.74
R7981:Scap UTSW 9 110384743 missense possibly damaging 0.74
X0064:Scap UTSW 9 110377645 missense probably damaging 1.00
Z1088:Scap UTSW 9 110372336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGGCTCTGTCCTGCTG -3'
(R):5'- CTAGCTGTTGAGTGCACAGAG -3'

Sequencing Primer
(F):5'- GCTGTCCTGACCACACTAG -3'
(R):5'- CAGAGATCAGGCCCCAAGTTG -3'
Posted On2020-04-21