Mutagenetix > Incidental Mutations

Incidental Mutation 'R7726:Scap'

628489

Institutional Source

Beutler Lab

Gene Symbol

Scap

Ensembl Gene

ENSMUSG00000032485

Gene Name

SREBF chaperone

Synonyms

Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110333288-110384950 bp(+) (GRCm38)

Type of Mutation

synonymous

DNA Base Change (assembly)

G to A at 110378367 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098350]

Predicted Effect

probably null
Transcript: ENSMUST00000098350

SMART Domains

Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
Pfam:Patched	279	504	4.7e-24	PFAM
Pfam:Sterol-sensing	308	459	7.6e-54	PFAM
transmembrane domain	515	534	N/A	INTRINSIC
transmembrane domain	711	733	N/A	INTRINSIC
low complexity region	741	751	N/A	INTRINSIC
WD40	765	802	1.79e-1	SMART
low complexity region	847	865	N/A	INTRINSIC
low complexity region	928	944	N/A	INTRINSIC
WD40	953	990	9.86e1	SMART
low complexity region	1050	1060	N/A	INTRINSIC
WD40	1062	1102	4.18e-2	SMART
WD40	1105	1143	5.64e-8	SMART
WD40	1147	1183	2.4e-1	SMART
WD40	1186	1223	2.56e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Scap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00581:Scap	APN	9	110376631	missense	probably damaging	1.00
IGL01012:Scap	APN	9	110362420	missense	probably damaging	1.00
IGL01487:Scap	APN	9	110377734	critical splice donor site	probably null
IGL01634:Scap	APN	9	110378789	critical splice donor site	probably null
IGL01725:Scap	APN	9	110381554	unclassified	probably benign
IGL01939:Scap	APN	9	110379481	missense	probably benign	0.02
IGL02106:Scap	APN	9	110381656	unclassified	probably benign
IGL02423:Scap	APN	9	110378617	missense	probably benign	0.02
IGL02487:Scap	APN	9	110378690	missense	probably benign	0.19
IGL02545:Scap	APN	9	110378690	missense	probably benign	0.19
IGL03226:Scap	APN	9	110384267	missense	possibly damaging	0.93
IGL03331:Scap	APN	9	110380236	unclassified	probably null
3-1:Scap	UTSW	9	110372968	intron	probably benign
R0027:Scap	UTSW	9	110379730	missense	probably benign	0.06
R0089:Scap	UTSW	9	110372222	missense	possibly damaging	0.81
R0742:Scap	UTSW	9	110381259	missense	probably damaging	1.00
R1416:Scap	UTSW	9	110384773	missense	probably damaging	1.00
R1785:Scap	UTSW	9	110374055	missense	probably damaging	0.97
R1996:Scap	UTSW	9	110372971	intron	probably benign
R2114:Scap	UTSW	9	110381273	missense	probably damaging	0.99
R2189:Scap	UTSW	9	110377693	missense	probably damaging	1.00
R2233:Scap	UTSW	9	110381593	missense	probably damaging	0.98
R2234:Scap	UTSW	9	110381593	missense	probably damaging	0.98
R2656:Scap	UTSW	9	110374019	missense	probably damaging	1.00
R3176:Scap	UTSW	9	110374025	missense	probably benign
R3237:Scap	UTSW	9	110379582	missense	probably damaging	0.96
R3276:Scap	UTSW	9	110374025	missense	probably benign
R3623:Scap	UTSW	9	110380203	missense	probably damaging	0.99
R3826:Scap	UTSW	9	110381297	missense	probably benign
R4859:Scap	UTSW	9	110374342	unclassified	probably benign
R4993:Scap	UTSW	9	110378390	missense	probably damaging	1.00
R5052:Scap	UTSW	9	110353152	missense	possibly damaging	0.89
R5330:Scap	UTSW	9	110381633	missense	probably benign	0.00
R5331:Scap	UTSW	9	110381633	missense	probably benign	0.00
R5383:Scap	UTSW	9	110374529	missense	probably damaging	0.99
R5410:Scap	UTSW	9	110374182	unclassified	probably null
R5531:Scap	UTSW	9	110381429	missense	possibly damaging	0.59
R5567:Scap	UTSW	9	110377644	missense	probably damaging	1.00
R5636:Scap	UTSW	9	110380594	missense	probably damaging	0.99
R5637:Scap	UTSW	9	110381572	missense	possibly damaging	0.94
R5859:Scap	UTSW	9	110374047	missense	probably benign	0.14
R5923:Scap	UTSW	9	110383580	missense	probably damaging	0.98
R5945:Scap	UTSW	9	110384596	missense	probably benign	0.00
R5987:Scap	UTSW	9	110381151	missense	probably damaging	1.00
R6075:Scap	UTSW	9	110378777	missense	probably damaging	1.00
R6130:Scap	UTSW	9	110380379	missense	possibly damaging	0.95
R6190:Scap	UTSW	9	110374067	missense	probably benign	0.01
R6567:Scap	UTSW	9	110383562	missense	probably damaging	1.00
R6999:Scap	UTSW	9	110384647	missense	probably damaging	1.00
R7098:Scap	UTSW	9	110372242	missense	possibly damaging	0.89
R7386:Scap	UTSW	9	110373169	missense	probably benign	0.00
R7642:Scap	UTSW	9	110374013	missense	probably damaging	1.00
R7898:Scap	UTSW	9	110384743	missense	possibly damaging	0.74
R7981:Scap	UTSW	9	110384743	missense	possibly damaging	0.74
X0064:Scap	UTSW	9	110377645	missense	probably damaging	1.00
Z1088:Scap	UTSW	9	110372336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAAGGCTCTGTCCTGCTG -3'
(R):5'- CTAGCTGTTGAGTGCACAGAG -3'

Sequencing Primer
(F):5'- GCTGTCCTGACCACACTAG -3'
(R):5'- CAGAGATCAGGCCCCAAGTTG -3'

Posted On

2020-04-21