Incidental Mutation 'R7726:Scap'
ID 628489
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene Name SREBF chaperone
Synonyms
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110162356-110214017 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 110207435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098350]
AlphaFold Q6GQT6
Predicted Effect probably null
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110,205,699 (GRCm39) missense probably damaging 1.00
IGL01012:Scap APN 9 110,191,488 (GRCm39) missense probably damaging 1.00
IGL01487:Scap APN 9 110,206,802 (GRCm39) critical splice donor site probably null
IGL01634:Scap APN 9 110,207,857 (GRCm39) critical splice donor site probably null
IGL01725:Scap APN 9 110,210,622 (GRCm39) unclassified probably benign
IGL01939:Scap APN 9 110,208,549 (GRCm39) missense probably benign 0.02
IGL02106:Scap APN 9 110,210,724 (GRCm39) unclassified probably benign
IGL02423:Scap APN 9 110,207,685 (GRCm39) missense probably benign 0.02
IGL02487:Scap APN 9 110,207,758 (GRCm39) missense probably benign 0.19
IGL02545:Scap APN 9 110,207,758 (GRCm39) missense probably benign 0.19
IGL03226:Scap APN 9 110,213,335 (GRCm39) missense possibly damaging 0.93
IGL03331:Scap APN 9 110,209,304 (GRCm39) splice site probably null
3-1:Scap UTSW 9 110,202,036 (GRCm39) intron probably benign
R0027:Scap UTSW 9 110,208,798 (GRCm39) missense probably benign 0.06
R0089:Scap UTSW 9 110,201,290 (GRCm39) missense possibly damaging 0.81
R0742:Scap UTSW 9 110,210,327 (GRCm39) missense probably damaging 1.00
R1416:Scap UTSW 9 110,213,841 (GRCm39) missense probably damaging 1.00
R1785:Scap UTSW 9 110,203,123 (GRCm39) missense probably damaging 0.97
R1996:Scap UTSW 9 110,202,039 (GRCm39) intron probably benign
R2114:Scap UTSW 9 110,210,341 (GRCm39) missense probably damaging 0.99
R2189:Scap UTSW 9 110,206,761 (GRCm39) missense probably damaging 1.00
R2233:Scap UTSW 9 110,210,661 (GRCm39) missense probably damaging 0.98
R2234:Scap UTSW 9 110,210,661 (GRCm39) missense probably damaging 0.98
R2656:Scap UTSW 9 110,203,087 (GRCm39) missense probably damaging 1.00
R3176:Scap UTSW 9 110,203,093 (GRCm39) missense probably benign
R3237:Scap UTSW 9 110,208,650 (GRCm39) missense probably damaging 0.96
R3276:Scap UTSW 9 110,203,093 (GRCm39) missense probably benign
R3623:Scap UTSW 9 110,209,271 (GRCm39) missense probably damaging 0.99
R3826:Scap UTSW 9 110,210,365 (GRCm39) missense probably benign
R4859:Scap UTSW 9 110,203,410 (GRCm39) unclassified probably benign
R4993:Scap UTSW 9 110,207,458 (GRCm39) missense probably damaging 1.00
R5052:Scap UTSW 9 110,182,220 (GRCm39) missense possibly damaging 0.89
R5330:Scap UTSW 9 110,210,701 (GRCm39) missense probably benign 0.00
R5331:Scap UTSW 9 110,210,701 (GRCm39) missense probably benign 0.00
R5383:Scap UTSW 9 110,203,597 (GRCm39) missense probably damaging 0.99
R5410:Scap UTSW 9 110,203,250 (GRCm39) splice site probably null
R5531:Scap UTSW 9 110,210,497 (GRCm39) missense possibly damaging 0.59
R5567:Scap UTSW 9 110,206,712 (GRCm39) missense probably damaging 1.00
R5636:Scap UTSW 9 110,209,662 (GRCm39) missense probably damaging 0.99
R5637:Scap UTSW 9 110,210,640 (GRCm39) missense possibly damaging 0.94
R5859:Scap UTSW 9 110,203,115 (GRCm39) missense probably benign 0.14
R5923:Scap UTSW 9 110,212,648 (GRCm39) missense probably damaging 0.98
R5945:Scap UTSW 9 110,213,664 (GRCm39) missense probably benign 0.00
R5987:Scap UTSW 9 110,210,219 (GRCm39) missense probably damaging 1.00
R6075:Scap UTSW 9 110,207,845 (GRCm39) missense probably damaging 1.00
R6130:Scap UTSW 9 110,209,447 (GRCm39) missense possibly damaging 0.95
R6190:Scap UTSW 9 110,203,135 (GRCm39) missense probably benign 0.01
R6567:Scap UTSW 9 110,212,630 (GRCm39) missense probably damaging 1.00
R6999:Scap UTSW 9 110,213,715 (GRCm39) missense probably damaging 1.00
R7098:Scap UTSW 9 110,201,310 (GRCm39) missense possibly damaging 0.89
R7386:Scap UTSW 9 110,202,237 (GRCm39) missense probably benign 0.00
R7642:Scap UTSW 9 110,203,081 (GRCm39) missense probably damaging 1.00
R7898:Scap UTSW 9 110,213,811 (GRCm39) missense possibly damaging 0.74
R8357:Scap UTSW 9 110,210,354 (GRCm39) missense probably benign 0.07
R8457:Scap UTSW 9 110,210,354 (GRCm39) missense probably benign 0.07
R8829:Scap UTSW 9 110,209,271 (GRCm39) missense probably damaging 0.99
R9381:Scap UTSW 9 110,207,839 (GRCm39) missense probably damaging 1.00
R9412:Scap UTSW 9 110,207,673 (GRCm39) missense possibly damaging 0.86
R9783:Scap UTSW 9 110,202,132 (GRCm39) missense probably benign 0.05
X0064:Scap UTSW 9 110,206,713 (GRCm39) missense probably damaging 1.00
Z1088:Scap UTSW 9 110,201,404 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGGCTCTGTCCTGCTG -3'
(R):5'- CTAGCTGTTGAGTGCACAGAG -3'

Sequencing Primer
(F):5'- GCTGTCCTGACCACACTAG -3'
(R):5'- CAGAGATCAGGCCCCAAGTTG -3'
Posted On 2020-04-21