Mutagenetix > Incidental Mutation

Incidental Mutation 'R0716:Ssb'

62849

Institutional Source

Beutler Lab

Gene Symbol

Ssb

Ensembl Gene

ENSMUSG00000068882

Gene Name

small RNA binding exonuclease protection factor La

Synonyms

SS-B, Sjogren syndrome antigen B, La protein, autoantigen La

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0716 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

69691906-69702190 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69697703 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 145 (T145A)

Ref Sequence

ENSEMBL: ENSMUSP00000130313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]

AlphaFold

P32067

Predicted Effect

probably benign
Transcript: ENSMUST00000060447

SMART Domains

Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
Pfam:Cons_hypoth95	21	184	1.8e-12	PFAM
Pfam:UPF0020	25	170	3.8e-8	PFAM
Pfam:PrmA	35	127	8.4e-14	PFAM
Pfam:MTS	36	174	2.2e-16	PFAM
Pfam:Methyltransf_31	49	199	4e-15	PFAM
Pfam:Methyltransf_18	51	171	8.1e-11	PFAM
Pfam:Methyltransf_15	52	179	1.1e-9	PFAM
Pfam:Methyltransf_26	52	182	3.9e-8	PFAM
Pfam:Methyltransf_25	55	171	5.2e-8	PFAM
Pfam:Methyltransf_11	56	131	8e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000090852
AA Change: T145A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882
AA Change: T145A

Domain	Start	End	E-Value	Type
LA	11	92	2.19e-42	SMART
RRM	112	183	1.6e-4	SMART
Pfam:RRM_3	230	333	2.2e-32	PFAM
low complexity region	375	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112260
AA Change: T145A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882
AA Change: T145A

Domain	Start	End	E-Value	Type
LA	11	92	2.19e-42	SMART
RRM	112	183	1.6e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132186
AA Change: T145A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882
AA Change: T145A

Domain	Start	End	E-Value	Type
LA	11	92	2.19e-42	SMART
Pfam:RRM_1	113	154	2.6e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132603

SMART Domains

Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882

Domain	Start	End	E-Value	Type
Pfam:RRM_3	46	149	2.5e-33	PFAM
low complexity region	190	201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135459

Predicted Effect

probably benign
Transcript: ENSMUST00000142127

SMART Domains

Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
Pfam:Cons_hypoth95	21	141	8.7e-12	PFAM
Pfam:UPF0020	24	141	1.4e-11	PFAM
Pfam:Methyltransf_16	31	126	5e-7	PFAM
Pfam:PrmA	34	127	4e-15	PFAM
Pfam:MTS	35	141	1.4e-17	PFAM
Pfam:Methyltransf_31	49	142	5.2e-15	PFAM
Pfam:Methyltransf_18	51	141	1.4e-11	PFAM
Pfam:Methyltransf_15	52	140	4.5e-9	PFAM
Pfam:Methyltransf_26	52	140	1.3e-14	PFAM
Pfam:Methyltransf_25	55	142	4.7e-8	PFAM
Pfam:Methyltransf_11	56	134	3.8e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166411
AA Change: T145A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882
AA Change: T145A

Domain	Start	End	E-Value	Type
LA	11	92	2.19e-42	SMART
RRM	112	183	1.6e-4	SMART
Pfam:RRM_3	230	333	1.9e-35	PFAM
low complexity region	375	386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149283

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 5 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bmal2	A	G	6: 146,731,218 (GRCm39)	S508G	possibly damaging	Het
Gm5444	A	G	13: 4,884,192 (GRCm39)		noncoding transcript	Het
Pkd1l2	A	T	8: 117,777,839 (GRCm39)	V904E	probably damaging	Het
Prl3b1	A	G	13: 27,427,779 (GRCm39)	T30A	probably benign	Het
Vmn2r110	T	C	17: 20,794,165 (GRCm39)	R835G	probably damaging	Het

Other mutations in Ssb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Ssb	APN	2	69,696,606 (GRCm39)	missense	probably benign	0.06
IGL00940:Ssb	APN	2	69,701,179 (GRCm39)	critical splice donor site	probably null
IGL00941:Ssb	APN	2	69,701,179 (GRCm39)	critical splice donor site	probably null
IGL01834:Ssb	APN	2	69,701,147 (GRCm39)	missense	possibly damaging	0.89
R0713:Ssb	UTSW	2	69,697,703 (GRCm39)	missense	probably benign	0.06
R0751:Ssb	UTSW	2	69,700,909 (GRCm39)	missense	probably benign
R1139:Ssb	UTSW	2	69,696,920 (GRCm39)	missense	possibly damaging	0.66
R1928:Ssb	UTSW	2	69,697,901 (GRCm39)	splice site	probably null
R2037:Ssb	UTSW	2	69,699,163 (GRCm39)	missense	probably benign	0.16
R3968:Ssb	UTSW	2	69,697,793 (GRCm39)	splice site	probably benign
R4674:Ssb	UTSW	2	69,699,194 (GRCm39)	missense	probably benign	0.01
R5039:Ssb	UTSW	2	69,696,581 (GRCm39)	missense	possibly damaging	0.79
R5551:Ssb	UTSW	2	69,701,474 (GRCm39)	missense	probably damaging	0.99
R6102:Ssb	UTSW	2	69,701,552 (GRCm39)	makesense	probably null
R7126:Ssb	UTSW	2	69,696,845 (GRCm39)	missense	possibly damaging	0.70
R7448:Ssb	UTSW	2	69,693,624 (GRCm39)	missense	probably benign
R7590:Ssb	UTSW	2	69,697,634 (GRCm39)	missense	probably benign	0.08
R9499:Ssb	UTSW	2	69,696,982 (GRCm39)	missense	probably benign
R9551:Ssb	UTSW	2	69,696,982 (GRCm39)	missense	probably benign
R9652:Ssb	UTSW	2	69,700,784 (GRCm39)	missense	probably damaging	1.00
R9753:Ssb	UTSW	2	69,697,865 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGGAGAGAAAGATACCTAGCTCTGACT -3'
(R):5'- AGGTGCTGTTGTTTACCTTACCCTATTG -3'

Sequencing Primer
(F):5'- AAGATACCTAGCTCTGACTTCGTTTC -3'
(R):5'- ATTTTGTGGTCTGAGAAACCTAAG -3'

Posted On

2013-07-30