Incidental Mutation 'R7726:Papss2'
ID 628490
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms Sk2, Atpsk2, 1810018P12Rik
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 32573190-32644587 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 32611403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
AlphaFold O88428
Predicted Effect probably null
Transcript: ENSMUST00000025833
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32,615,658 (GRCm39) missense probably damaging 1.00
IGL01646:Papss2 APN 19 32,629,482 (GRCm39) missense probably benign
IGL02052:Papss2 APN 19 32,637,983 (GRCm39) missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32,611,404 (GRCm39) splice site probably benign
diablo UTSW 19 32,615,760 (GRCm39) missense probably damaging 1.00
R0091:Papss2 UTSW 19 32,611,302 (GRCm39) missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32,615,768 (GRCm39) nonsense probably null
R0708:Papss2 UTSW 19 32,614,616 (GRCm39) missense probably damaging 0.97
R1336:Papss2 UTSW 19 32,615,715 (GRCm39) missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32,614,490 (GRCm39) missense probably benign 0.02
R1931:Papss2 UTSW 19 32,616,368 (GRCm39) nonsense probably null
R4025:Papss2 UTSW 19 32,629,323 (GRCm39) missense probably damaging 0.98
R4369:Papss2 UTSW 19 32,618,791 (GRCm39) missense probably damaging 1.00
R4762:Papss2 UTSW 19 32,616,378 (GRCm39) missense probably benign 0.05
R5235:Papss2 UTSW 19 32,616,619 (GRCm39) missense probably benign 0.00
R5294:Papss2 UTSW 19 32,616,400 (GRCm39) missense probably benign 0.03
R5320:Papss2 UTSW 19 32,615,787 (GRCm39) missense probably damaging 1.00
R5721:Papss2 UTSW 19 32,638,064 (GRCm39) missense probably damaging 1.00
R5768:Papss2 UTSW 19 32,638,119 (GRCm39) splice site probably null
R5982:Papss2 UTSW 19 32,616,636 (GRCm39) missense probably benign
R6124:Papss2 UTSW 19 32,614,528 (GRCm39) missense probably damaging 1.00
R6395:Papss2 UTSW 19 32,641,876 (GRCm39) missense probably damaging 1.00
R6546:Papss2 UTSW 19 32,640,548 (GRCm39) missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32,629,342 (GRCm39) splice site probably null
R7055:Papss2 UTSW 19 32,641,827 (GRCm39) missense probably damaging 1.00
R7315:Papss2 UTSW 19 32,616,625 (GRCm39) missense possibly damaging 0.60
R7753:Papss2 UTSW 19 32,597,579 (GRCm39) missense probably benign 0.00
R7991:Papss2 UTSW 19 32,629,403 (GRCm39) missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32,618,742 (GRCm39) missense probably benign 0.24
R8275:Papss2 UTSW 19 32,615,760 (GRCm39) missense probably damaging 1.00
R9135:Papss2 UTSW 19 32,618,764 (GRCm39) missense probably damaging 1.00
R9425:Papss2 UTSW 19 32,615,750 (GRCm39) missense possibly damaging 0.61
X0028:Papss2 UTSW 19 32,615,795 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GACACTGTTGTATACTGCAACTC -3'
(R):5'- AATCTGCTTAGGGGTGCATAGG -3'

Sequencing Primer
(F):5'- TGTATGTGTTCTGTGTAAAGCATAC -3'
(R):5'- CTTAGGGGTGCATAGGAGAAGCTC -3'
Posted On 2020-04-21