Incidental Mutation 'R7784:C130026I21Rik'
ID 628498
Institutional Source Beutler Lab
Gene Symbol C130026I21Rik
Ensembl Gene ENSMUSG00000052477
Gene Name RIKEN cDNA C130026I21 gene
Synonyms OTTMUSG00000029174
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R7784 (G1)
Quality Score 197.009
Status Validated
Chromosome 1
Chromosomal Location 84992690-85270566 bp(-) (GRCm38)
Type of Mutation splice site (49361 bp from exon)
DNA Base Change (assembly) T to A at 85212474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161267] [ENSMUST00000162421]
AlphaFold Q8C898
Predicted Effect probably benign
Transcript: ENSMUST00000161267
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162421
SMART Domains Protein: ENSMUSP00000125215
Gene: ENSMUSG00000052477

DomainStartEndE-ValueType
Pfam:Sp100 40 135 2.2e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in C130026I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:C130026I21Rik APN 1 85254186 intron probably benign
IGL01876:C130026I21Rik APN 1 85254186 intron probably benign
IGL01880:C130026I21Rik APN 1 85254186 intron probably benign
IGL01883:C130026I21Rik APN 1 85254186 intron probably benign
IGL01886:C130026I21Rik APN 1 85254186 intron probably benign
IGL01888:C130026I21Rik APN 1 85254186 intron probably benign
IGL01893:C130026I21Rik APN 1 85254186 intron probably benign
IGL01898:C130026I21Rik APN 1 85254186 intron probably benign
IGL01906:C130026I21Rik APN 1 85254186 intron probably benign
IGL01908:C130026I21Rik APN 1 85254186 intron probably benign
IGL01909:C130026I21Rik APN 1 85254186 intron probably benign
IGL01916:C130026I21Rik APN 1 85254186 intron probably benign
IGL01918:C130026I21Rik APN 1 85254186 intron probably benign
IGL01920:C130026I21Rik APN 1 85254186 intron probably benign
IGL01923:C130026I21Rik APN 1 85254186 intron probably benign
IGL01928:C130026I21Rik APN 1 85254186 intron probably benign
IGL01933:C130026I21Rik APN 1 85254186 intron probably benign
IGL01945:C130026I21Rik APN 1 85254186 intron probably benign
IGL01949:C130026I21Rik APN 1 85254186 intron probably benign
IGL01951:C130026I21Rik APN 1 85254186 intron probably benign
IGL01952:C130026I21Rik APN 1 85254186 intron probably benign
PIT4131001:C130026I21Rik UTSW 1 85245674 intron probably benign
PIT4142001:C130026I21Rik UTSW 1 85245674 intron probably benign
R0067:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R0367:C130026I21Rik UTSW 1 85270103 start gained probably benign
R0389:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R1284:C130026I21Rik UTSW 1 85270055 missense probably damaging 0.98
R1620:C130026I21Rik UTSW 1 85254186 intron probably benign
R1622:C130026I21Rik UTSW 1 85254186 intron probably benign
R1671:C130026I21Rik UTSW 1 85257385 critical splice donor site probably null
R3115:C130026I21Rik UTSW 1 85257385 intron probably benign
R4120:C130026I21Rik UTSW 1 85259821 missense possibly damaging 0.82
R4223:C130026I21Rik UTSW 1 85112557 missense probably damaging 0.98
R4947:C130026I21Rik UTSW 1 85112482 missense probably damaging 1.00
R4996:C130026I21Rik UTSW 1 85247094 missense probably benign 0.12
R5152:C130026I21Rik UTSW 1 85261860 missense probably benign 0.04
R6614:C130026I21Rik UTSW 1 85202060 splice site probably null
R7675:C130026I21Rik UTSW 1 85247015 missense probably benign
R7839:C130026I21Rik UTSW 1 85247015 missense probably benign
R8010:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R8034:C130026I21Rik UTSW 1 85254160 missense probably benign 0.35
R8382:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R8431:C130026I21Rik UTSW 1 85257449 missense probably benign 0.00
R8690:C130026I21Rik UTSW 1 85257449 missense probably benign 0.00
R8951:C130026I21Rik UTSW 1 85246950 missense possibly damaging 0.53
R9150:C130026I21Rik UTSW 1 85113638 missense probably damaging 0.96
R9204:C130026I21Rik UTSW 1 85257449 missense probably benign 0.00
Z1176:C130026I21Rik UTSW 1 85113523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCCTGACCTTAACTGCTAC -3'
(R):5'- TGCTCAGAAGACGAGTTCATGG -3'

Sequencing Primer
(F):5'- GACCTTAACTGCTACCTTGGAAC -3'
(R):5'- AGACGAGTTCATGGTCTTCAG -3'
Posted On 2020-04-21