Mutagenetix > Incidental Mutations

Incidental Mutation 'R7784:Mad2l1'

628500

Institutional Source

Beutler Lab

Gene Symbol

Mad2l1

Ensembl Gene

ENSMUSG00000029910

Gene Name

MAD2 mitotic arrest deficient-like 1

Synonyms

MAD2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66535390-66547220 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 66535413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101343] [ENSMUST00000116605]

AlphaFold

Q9Z1B5

Predicted Effect

probably benign
Transcript: ENSMUST00000101343

SMART Domains

Protein: ENSMUSP00000098897
Gene: ENSMUSG00000029910

Domain	Start	End	E-Value	Type
Pfam:HORMA	13	203	1.5e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000116605

SMART Domains

Protein: ENSMUSP00000112304
Gene: ENSMUSG00000029910

Domain	Start	End	E-Value	Type
Pfam:HORMA	12	191	7.2e-48	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD2L1 is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is related to the MAD2L2 gene located on chromosome 1. A MAD2 pseudogene has been mapped to chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die at E6.5-7.5. At E5.5, embryonic cells assemble spindles and undergo mitosis but do not arrest in response to microtubule depolymerization. At E6.5, loss of a functional spindle assembly ckeckpoint results in widespread chromosome missegregation and apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Mad2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Mad2l1	APN	6	66537602	missense	possibly damaging	0.93
IGL02546:Mad2l1	APN	6	66535967	missense	probably damaging	0.96
R0190:Mad2l1	UTSW	6	66539878	missense	possibly damaging	0.92
R1436:Mad2l1	UTSW	6	66539813	missense	possibly damaging	0.57
R1498:Mad2l1	UTSW	6	66539842	nonsense	probably null
R1753:Mad2l1	UTSW	6	66539813	missense	possibly damaging	0.57
R5308:Mad2l1	UTSW	6	66537691	critical splice donor site	probably null
R6195:Mad2l1	UTSW	6	66537628	missense	possibly damaging	0.95
R7327:Mad2l1	UTSW	6	66539810	missense	probably benign
R8756:Mad2l1	UTSW	6	66535585	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAACCCGTGGTGCAACTGG -3'
(R):5'- CGAGTAAGATGATGACCCAGGTC -3'

Sequencing Primer
(F):5'- CGTGGTGCAACTGGGCATAG -3'
(R):5'- GATCCGTGGTTCCGTCCTAG -3'

Posted On

2020-04-21