Incidental Mutation 'R7784:Mrpl2'
ID 628502
Institutional Source Beutler Lab
Gene Symbol Mrpl2
Ensembl Gene ENSMUSG00000002767
Gene Name mitochondrial ribosomal protein L2
Synonyms CGI-22, Rpml14, MRP-L14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 46646229-46650139 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 46648591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002844] [ENSMUST00000003642] [ENSMUST00000043464] [ENSMUST00000113429] [ENSMUST00000113430] [ENSMUST00000133393] [ENSMUST00000145567]
AlphaFold Q9D773
Predicted Effect probably null
Transcript: ENSMUST00000002844
SMART Domains Protein: ENSMUSP00000002844
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Ribosomal_L2 84 166 3.44e-29 SMART
Ribosomal_L2_C 177 298 1.32e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003642
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043464
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000113429
SMART Domains Protein: ENSMUSP00000109056
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 84 166 1.1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113430
SMART Domains Protein: ENSMUSP00000109057
Gene: ENSMUSG00000002767

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_L2 82 164 1.6e-31 PFAM
Pfam:Ribosomal_L2_C 175 279 5.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL2 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 12q. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Mrpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Mrpl2 APN 17 46649983 missense probably damaging 1.00
IGL01757:Mrpl2 APN 17 46648257 missense probably damaging 1.00
IGL02292:Mrpl2 APN 17 46648231 unclassified probably benign
IGL03177:Mrpl2 APN 17 46649037 missense probably damaging 0.99
IGL03326:Mrpl2 APN 17 46649927 missense possibly damaging 0.78
R1620:Mrpl2 UTSW 17 46647499 missense probably benign 0.28
R2567:Mrpl2 UTSW 17 46647501 missense probably benign 0.17
R4573:Mrpl2 UTSW 17 46649041 missense possibly damaging 0.89
R5102:Mrpl2 UTSW 17 46650038 missense probably benign 0.11
R5103:Mrpl2 UTSW 17 46650038 missense probably benign 0.11
R5283:Mrpl2 UTSW 17 46649066 missense possibly damaging 0.83
R5405:Mrpl2 UTSW 17 46649110 critical splice donor site probably null
R6199:Mrpl2 UTSW 17 46649086 missense probably damaging 1.00
R6225:Mrpl2 UTSW 17 46649909 missense probably damaging 0.98
R6232:Mrpl2 UTSW 17 46647430 missense probably benign 0.01
R6841:Mrpl2 UTSW 17 46647456 missense probably benign 0.31
R7170:Mrpl2 UTSW 17 46648255 missense probably damaging 1.00
R7831:Mrpl2 UTSW 17 46648672 missense possibly damaging 0.93
R8284:Mrpl2 UTSW 17 46647509 nonsense probably null
R8938:Mrpl2 UTSW 17 46646312 unclassified probably benign
X0018:Mrpl2 UTSW 17 46648351 missense probably damaging 1.00
Z1088:Mrpl2 UTSW 17 46647478 missense probably null 0.14
Predicted Primers PCR Primer
(F):5'- CCGCTATGATCCTTGTAGGC -3'
(R):5'- CTGCAGCTCGGATATACTGG -3'

Sequencing Primer
(F):5'- AAATGATGATGGTGTGGTCTGAATTG -3'
(R):5'- TCGGATATACTGGGCTCCC -3'
Posted On 2020-04-21