Incidental Mutation 'R7686:Agmo'
ID628504
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7686 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37419974 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 431 (V431A)
Ref Sequence ENSEMBL: ENSMUSP00000123801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390]
Predicted Effect probably benign
Transcript: ENSMUST00000049874
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159998
AA Change: V431A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103
AA Change: V431A

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160390
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,249,052 N208S probably benign Het
9930021J03Rik A T 19: 29,717,470 I1541N probably benign Het
Acadl A T 1: 66,848,398 probably null Het
Adgrg5 A T 8: 94,937,802 I347F Het
Arl14epl A G 18: 46,932,456 D96G probably damaging Het
Asxl1 C T 2: 153,391,614 S113F probably damaging Het
Axdnd1 A T 1: 156,395,464 C81* probably null Het
Bloc1s3 C T 7: 19,507,606 probably benign Het
Bmper C G 9: 23,399,544 L425V probably benign Het
Bok A T 1: 93,695,100 T194S probably benign Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Brpf3 T C 17: 28,806,934 I327T probably damaging Het
Camk1 T A 6: 113,336,197 N297Y probably damaging Het
Catsper2 C T 2: 121,397,456 probably null Het
Ccdc171 A T 4: 83,657,319 N480I unknown Het
Cd163l1 T A 7: 140,222,203 C148* probably null Het
Cd83 A G 13: 43,785,372 M22V probably benign Het
Col1a2 A G 6: 4,518,964 D243G unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Ctla4 A T 1: 60,912,593 T94S probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Dhx32 A T 7: 133,759,701 M1K probably null Het
Epha3 T A 16: 63,773,288 I146F probably damaging Het
Erbb2 T A 11: 98,435,573 S1008T probably benign Het
Esp34 A G 17: 38,559,643 R143G possibly damaging Het
Fam135b T C 15: 71,463,384 K654E possibly damaging Het
Fgr T C 4: 132,998,013 M343T probably benign Het
Fibcd1 T G 2: 31,833,868 D253A probably damaging Het
Foxk1 C T 5: 142,401,870 S116L probably damaging Het
Gimap8 G A 6: 48,656,072 G275E probably damaging Het
Glp1r T C 17: 30,925,659 Y269H probably damaging Het
Gm5136 T C 10: 108,699,440 E218G probably damaging Het
Gm9008 A T 6: 76,497,030 L201H probably damaging Het
Hist2h2ac T C 3: 96,220,570 E92G probably damaging Het
Lbr A G 1: 181,817,521 F522S probably damaging Het
Lca5 T C 9: 83,395,239 N684S probably benign Het
Leng8 C A 7: 4,143,505 S372* probably null Het
Lrp2 A G 2: 69,489,237 Y1981H probably damaging Het
Lrrc37a T G 11: 103,498,236 Q2121P unknown Het
Lrrn2 A G 1: 132,938,594 T466A probably benign Het
Map3k19 A T 1: 127,822,248 L1122* probably null Het
Mfsd6 T C 1: 52,662,395 E632G probably benign Het
Mfsd6l C T 11: 68,557,226 A301V probably benign Het
Mro A T 18: 73,877,439 M197L probably benign Het
Ncam2 A T 16: 81,621,454 E799V probably damaging Het
Nek9 A T 12: 85,303,659 D880E probably benign Het
Ntng1 T A 3: 109,935,014 I148L possibly damaging Het
Olfr1378 A G 11: 50,969,755 T246A possibly damaging Het
Olfr205 T A 16: 59,329,016 R164S probably damaging Het
P2ry13 C T 3: 59,210,018 G113D probably damaging Het
Pnpt1 A T 11: 29,157,070 T687S probably damaging Het
Pou2af1 T C 9: 51,238,186 Y193H probably damaging Het
Ppp1r14c T A 10: 3,463,396 I143N probably damaging Het
Ppp1r16a A T 15: 76,694,583 S496C probably benign Het
Prdm12 G A 2: 31,640,217 R40Q probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 C A 16: 73,958,405 V743F probably damaging Het
Smg1 A T 7: 118,167,858 Y1804N unknown Het
Ssh2 A G 11: 77,425,324 E257G possibly damaging Het
Stoml3 T C 3: 53,503,168 I101T probably damaging Het
Stxbp5 T C 10: 9,769,410 D950G probably damaging Het
Syt10 T C 15: 89,814,157 D328G probably damaging Het
Taf3 T C 2: 9,951,488 K623E probably damaging Het
Tas2r134 T A 2: 51,628,243 S245T possibly damaging Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Tjp3 C T 10: 81,278,051 V458I probably benign Het
Tnpo3 G T 6: 29,562,900 S606* probably null Het
Tram1l1 T C 3: 124,321,310 F40L probably benign Het
Ttc29 A T 8: 78,393,130 T464S probably benign Het
Txndc9 A T 1: 37,987,768 M192K probably benign Het
Urb2 C A 8: 124,045,172 A1444E probably benign Het
Uty G A Y: 1,158,075 T657I possibly damaging Het
Vmn1r1 A T 1: 182,158,025 V25D probably damaging Het
Vmn2r65 A T 7: 84,940,536 I724N probably damaging Het
Xkr6 C T 14: 63,606,846 T106M possibly damaging Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp341 A G 2: 154,624,861 E50G probably damaging Het
Zfp62 C A 11: 49,217,158 A692E probably damaging Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R3440:Agmo UTSW 12 37243800 missense probably damaging 1.00
R5263:Agmo UTSW 12 37357681 missense probably benign 0.01
R6249:Agmo UTSW 12 37243838 critical splice donor site probably null
R6251:Agmo UTSW 12 37252539 missense probably damaging 1.00
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R8071:Agmo UTSW 12 37398729 missense probably damaging 1.00
R8089:Agmo UTSW 12 37347307 missense probably benign 0.03
R8511:Agmo UTSW 12 37244397 makesense probably null
R8534:Agmo UTSW 12 37252539 missense probably damaging 1.00
R8712:Agmo UTSW 12 37357674 missense possibly damaging 0.77
R8845:Agmo UTSW 12 37244365 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTCTAAGGGGATGCATTTGATGG -3'
(R):5'- TTGCTTTCCACAAACTGACCA -3'

Sequencing Primer
(F):5'- TAAGGCTAAATGGTCCACGGTCTC -3'
(R):5'- CCCATTGAACTGTAGATACTGAGTGG -3'
Posted On2020-04-27