Incidental Mutation 'R7750:Bard1'
ID628509
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene NameBRCA1 associated RING domain 1
SynonymsENSMUSG00000060893, ENSMUSG00000073653
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7750 (G1)
Quality Score187.009
Status Validated
Chromosome1
Chromosomal Location71027498-71103146 bp(-) (GRCm38)
Type of Mutationintron (166 bp from exon)
DNA Base Change (assembly) T to A at 71066942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
Predicted Effect probably null
Transcript: ENSMUST00000027393
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,200 D816V possibly damaging Het
Abca16 A T 7: 120,514,705 N933I probably benign Het
Acly A T 11: 100,478,013 probably null Het
Acox1 C T 11: 116,183,580 G105D possibly damaging Het
Ankrd24 A G 10: 81,646,794 E939G possibly damaging Het
Brd4 G T 17: 32,213,547 N579K unknown Het
C1qc T C 4: 136,890,281 Y168C probably damaging Het
Casp6 A G 3: 129,912,209 D175G probably damaging Het
Ccdc83 A T 7: 90,223,982 Y388* probably null Het
Clasrp A T 7: 19,584,591 *628R probably null Het
Cox4i1 A G 8: 120,673,310 I111V probably benign Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Epb41l4b C T 4: 57,076,913 probably null Het
Frem2 C A 3: 53,523,682 L2743F possibly damaging Het
Frmd4a A T 2: 4,601,349 H628L probably benign Het
Fyb A G 15: 6,660,703 D809G probably damaging Het
Gm19410 T A 8: 35,807,498 M1491K possibly damaging Het
Gm3604 G A 13: 62,369,996 H183Y possibly damaging Het
H1fnt A G 15: 98,256,684 S195P unknown Het
Lama2 T C 10: 26,990,924 Y2858C probably damaging Het
Methig1 T C 15: 100,353,531 F108L probably benign Het
Mfsd4b5 A G 10: 39,970,255 V443A probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myh9 C T 15: 77,783,410 V608I probably benign Het
Myo1g T C 11: 6,514,849 D475G probably damaging Het
Neb A C 2: 52,280,716 probably null Het
Nlrp1b T A 11: 71,168,839 I769F probably benign Het
Nol8 G T 13: 49,662,266 V617F possibly damaging Het
Olfr715b A T 7: 107,106,533 C109* probably null Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pou3f3 T A 1: 42,698,148 F335I probably damaging Het
Ppp1r3e T C 14: 54,876,627 D196G probably damaging Het
Prpf40a T C 2: 53,151,745 T545A probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rprd1a T A 18: 24,508,254 K102* probably null Het
Sim1 A G 10: 50,896,035 T47A possibly damaging Het
Slc45a1 C T 4: 150,644,041 A102T probably damaging Het
Slc6a11 C T 6: 114,230,137 P361S possibly damaging Het
Slc9b2 T C 3: 135,326,237 F286S probably damaging Het
Slco4a1 T C 2: 180,471,237 S421P probably benign Het
Snap91 A C 9: 86,798,709 probably null Het
Sppl2a A G 2: 126,919,705 L293P probably damaging Het
Sval3 T A 6: 41,972,426 I66K possibly damaging Het
Synj2bp T C 12: 81,504,537 I85V probably benign Het
Thop1 G T 10: 81,080,191 A403S probably benign Het
Timd4 T A 11: 46,815,527 M52K probably damaging Het
Tmco5b A G 2: 113,288,264 N111D probably damaging Het
Trip10 G A 17: 57,261,667 V419I possibly damaging Het
Trpv3 T C 11: 73,286,021 Y409H probably damaging Het
Tulp4 A G 17: 6,233,124 T1143A probably damaging Het
Ugt2b5 A T 5: 87,140,249 S20T probably benign Het
Unc5b A G 10: 60,775,044 F406L probably benign Het
Usf3 A G 16: 44,220,521 E1788G probably benign Het
Usp45 A G 4: 21,780,430 D27G probably damaging Het
Vmn2r100 G A 17: 19,522,464 V367I probably benign Het
Vmn2r49 T A 7: 9,976,258 K849I probably damaging Het
Zfp119b A T 17: 55,938,682 H501Q probably damaging Het
Zfp462 C A 4: 55,016,958 H893N probably benign Het
Zkscan4 A G 13: 21,479,355 E88G probably damaging Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71031426 missense probably benign 0.08
IGL02128:Bard1 APN 1 71075228 missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71053669 missense probably damaging 1.00
IGL02552:Bard1 APN 1 71065656 splice site probably benign
IGL02661:Bard1 APN 1 71075310 missense probably damaging 1.00
IGL03087:Bard1 APN 1 71067130 missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71074928 missense probably benign 0.00
R0096:Bard1 UTSW 1 71053730 splice site probably benign
R0328:Bard1 UTSW 1 71046762 missense probably benign 0.29
R0838:Bard1 UTSW 1 71030653 missense probably damaging 1.00
R2007:Bard1 UTSW 1 71031403 missense probably benign 0.00
R2055:Bard1 UTSW 1 71074872 missense probably benign 0.00
R2110:Bard1 UTSW 1 71075391 nonsense probably null
R2237:Bard1 UTSW 1 71074976 missense probably damaging 1.00
R2416:Bard1 UTSW 1 71074652 missense probably benign
R3054:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71074940 missense probably benign 0.05
R3905:Bard1 UTSW 1 71067180 missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71046763 missense probably damaging 1.00
R4766:Bard1 UTSW 1 71075174 missense probably benign 0.01
R5230:Bard1 UTSW 1 71053611 critical splice donor site probably null
R5250:Bard1 UTSW 1 71074563 missense probably damaging 1.00
R5531:Bard1 UTSW 1 71046721 missense probably damaging 1.00
R5653:Bard1 UTSW 1 71031429 missense probably benign
R6008:Bard1 UTSW 1 71030750 missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71030836 missense probably damaging 1.00
R7543:Bard1 UTSW 1 71075430 missense probably damaging 1.00
R8134:Bard1 UTSW 1 71067138 missense probably damaging 1.00
V8831:Bard1 UTSW 1 71088217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTTCCAGTAGCACACAATG -3'
(R):5'- TCTTGCAAAATGGAAACGACCC -3'

Sequencing Primer
(F):5'- TCCAACGATGCAGTGAAG -3'
(R):5'- CCAAATGTTAAAGACCATGCTGG -3'
Posted On2020-04-27