Incidental Mutation 'R7757:Sept11'
ID 628513
Institutional Source Beutler Lab
Gene Symbol Sept11
Ensembl Gene ENSMUSG00000058013
Gene Name septin 11
Synonyms 6230410I01Rik, D5Ertd606e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R7757 (G1)
Quality Score 90.0077
Status Validated
Chromosome 5
Chromosomal Location 93093437-93176447 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 93171464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074733] [ENSMUST00000201421] [ENSMUST00000201700] [ENSMUST00000202217] [ENSMUST00000202308]
AlphaFold Q8C1B7
Predicted Effect probably benign
Transcript: ENSMUST00000074733
SMART Domains Protein: ENSMUSP00000074293
Gene: ENSMUSG00000058013

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201421
SMART Domains Protein: ENSMUSP00000143928
Gene: ENSMUSG00000058013

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201700
SMART Domains Protein: ENSMUSP00000143901
Gene: ENSMUSG00000058013

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.9e-99 PFAM
Pfam:MMR_HSR1 43 185 7e-7 PFAM
coiled coil region 333 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202217
SMART Domains Protein: ENSMUSP00000144235
Gene: ENSMUSG00000058013

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.7e-101 PFAM
Pfam:MMR_HSR1 43 185 4.1e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202308
SMART Domains Protein: ENSMUSP00000144136
Gene: ENSMUSG00000058013

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.1e-101 PFAM
Pfam:MMR_HSR1 43 185 3.7e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Sept11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept11 APN 5 93157018 splice site probably null
IGL00984:Sept11 APN 5 93162184 missense possibly damaging 0.90
IGL01452:Sept11 APN 5 93161204 missense possibly damaging 0.82
IGL01677:Sept11 APN 5 93148533 missense probably damaging 0.98
IGL01732:Sept11 APN 5 93161226 missense probably damaging 1.00
IGL02476:Sept11 APN 5 93148584 critical splice donor site probably null
I0000:Sept11 UTSW 5 93165259 missense probably benign 0.05
R0544:Sept11 UTSW 5 93165368 missense possibly damaging 0.80
R0611:Sept11 UTSW 5 93167534 missense probably damaging 0.99
R1438:Sept11 UTSW 5 93148428 missense probably damaging 1.00
R1702:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R1727:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R3838:Sept11 UTSW 5 93148399 missense probably damaging 1.00
R3847:Sept11 UTSW 5 93162167 missense probably damaging 1.00
R4609:Sept11 UTSW 5 93162254 missense possibly damaging 0.89
R4717:Sept11 UTSW 5 93156956 missense possibly damaging 0.89
R4852:Sept11 UTSW 5 93162253 missense possibly damaging 0.52
R4986:Sept11 UTSW 5 93161241 missense probably damaging 1.00
R5806:Sept11 UTSW 5 93167578 missense probably benign 0.18
R5826:Sept11 UTSW 5 93139450 missense possibly damaging 0.79
R5896:Sept11 UTSW 5 93156965 missense probably damaging 1.00
R6641:Sept11 UTSW 5 93139552 missense probably damaging 1.00
R7144:Sept11 UTSW 5 93156866 missense probably benign 0.00
R7479:Sept11 UTSW 5 93156945 missense probably damaging 0.99
R8056:Sept11 UTSW 5 93167576 missense unknown
R8103:Sept11 UTSW 5 93161148 critical splice acceptor site probably null
R9152:Sept11 UTSW 5 93139470 missense probably benign 0.00
R9429:Sept11 UTSW 5 93173538 critical splice donor site probably null
R9717:Sept11 UTSW 5 93148407 missense possibly damaging 0.95
Z1177:Sept11 UTSW 5 93156963 missense probably damaging 0.96
Z1177:Sept11 UTSW 5 93162283 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCCCATAATCATTGCATGAGC -3'
(R):5'- TCCAAAGCGACATACAAGGG -3'

Sequencing Primer
(F):5'- AATGCTGGCGCTGGTACTC -3'
(R):5'- TACAAGGGACAGACATGCTTCCTG -3'
Posted On 2020-04-27