Incidental Mutation 'R7720:Lman2'
ID 628521
Institutional Source Beutler Lab
Gene Symbol Lman2
Ensembl Gene ENSMUSG00000021484
Gene Name lectin, mannose-binding 2
Synonyms 1110003H06Rik, GP36B, VIP36, 1300009F09Rik
MMRRC Submission 067892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R7720 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55491646-55510596 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 55500890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021940]
AlphaFold Q9DBH5
Predicted Effect probably null
Transcript: ENSMUST00000021940
SMART Domains Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
Pfam:Lectin_leg-like 54 280 6.6e-104 PFAM
transmembrane domain 325 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,926,957 (GRCm39) D1018G probably damaging Het
Atm T C 9: 53,433,539 (GRCm39) N237S possibly damaging Het
Card6 G T 15: 5,127,905 (GRCm39) Q1164K unknown Het
Ccdc202 A G 14: 96,119,548 (GRCm39) R102G probably benign Het
Cped1 G A 6: 22,222,430 (GRCm39) C730Y probably damaging Het
Csmd1 A T 8: 15,981,108 (GRCm39) L2770Q probably damaging Het
Ctsw T C 19: 5,517,072 (GRCm39) T87A probably damaging Het
Dock4 T C 12: 40,856,974 (GRCm39) I1269T probably damaging Het
F11 T C 8: 45,705,127 (GRCm39) E138G possibly damaging Het
Fam124b A G 1: 80,177,974 (GRCm39) S342P probably damaging Het
Garin2 T C 12: 78,758,907 (GRCm39) S76P probably damaging Het
Gipr T C 7: 18,896,884 (GRCm39) I129V probably benign Het
Gria4 A T 9: 4,464,288 (GRCm39) V558D probably damaging Het
Gsdme C T 6: 50,206,288 (GRCm39) G185E probably damaging Het
Hapstr1 T A 16: 8,660,966 (GRCm39) C148S probably damaging Het
Hgd T A 16: 37,413,797 (GRCm39) D86E probably benign Het
Hmcn1 T A 1: 150,522,460 (GRCm39) H3480L probably benign Het
Hs2st1 T C 3: 144,159,783 (GRCm39) N127D probably damaging Het
Ilf3 A G 9: 21,310,833 (GRCm39) N599S possibly damaging Het
Itsn1 G A 16: 91,664,971 (GRCm39) G1132R unknown Het
Jakmip2 A G 18: 43,704,973 (GRCm39) S343P possibly damaging Het
Kif1b A G 4: 149,266,812 (GRCm39) V1670A probably benign Het
Ltbp1 A T 17: 75,692,119 (GRCm39) Y1579F probably damaging Het
Mon2 G A 10: 122,868,493 (GRCm39) A520V probably benign Het
Mrpl10 T G 11: 96,938,363 (GRCm39) V171G possibly damaging Het
Mrps27 A T 13: 99,537,838 (GRCm39) T153S unknown Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nlrp10 A G 7: 108,523,695 (GRCm39) V595A probably benign Het
Nol4 A T 18: 23,173,080 (GRCm39) M7K probably benign Het
Oasl1 G A 5: 115,067,980 (GRCm39) S188N probably damaging Het
Or2d3c C A 7: 106,526,618 (GRCm39) G16V probably benign Het
Or5h25 T C 16: 58,930,134 (GRCm39) I280V probably benign Het
Pcdhga2 A G 18: 37,802,993 (GRCm39) Y279C probably damaging Het
Pfpl C T 19: 12,406,538 (GRCm39) A263V probably benign Het
Phf3 T G 1: 30,868,938 (GRCm39) K703N probably damaging Het
Pik3ca C G 3: 32,490,367 (GRCm39) P5A probably damaging Het
Plekha6 T C 1: 133,221,445 (GRCm39) V987A probably damaging Het
Ppp3ca T A 3: 136,596,250 (GRCm39) I305N probably damaging Het
Prex2 A G 1: 11,252,161 (GRCm39) K1069E possibly damaging Het
Prss50 T C 9: 110,690,403 (GRCm39) V182A probably damaging Het
Ptprg A G 14: 12,211,703 (GRCm38) N995S probably benign Het
Robo2 C A 16: 73,693,903 (GRCm39) G1375V probably benign Het
Rtl1 T C 12: 109,560,864 (GRCm39) Y325C possibly damaging Het
Semp2l1 T C 1: 32,585,178 (GRCm39) D244G probably benign Het
Shcbp1 A C 8: 4,798,720 (GRCm39) S400A probably damaging Het
Shfl C T 9: 20,780,155 (GRCm39) probably benign Het
Sirpb1c T A 3: 15,886,236 (GRCm39) Y380F probably benign Het
Tbl2 G C 5: 135,188,329 (GRCm39) L374F probably damaging Het
Tpr C A 1: 150,305,283 (GRCm39) A1524E possibly damaging Het
Vmn2r45 T A 7: 8,486,460 (GRCm39) E276V probably damaging Het
Vps16 C T 2: 130,283,623 (GRCm39) Q606* probably null Het
Vstm5 A T 9: 15,150,652 (GRCm39) Q29L probably benign Het
Wipi1 G T 11: 109,473,249 (GRCm39) S250Y probably damaging Het
Other mutations in Lman2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lman2 APN 13 55,499,055 (GRCm39) missense possibly damaging 0.91
IGL02381:Lman2 APN 13 55,499,282 (GRCm39) missense possibly damaging 0.77
R0331:Lman2 UTSW 13 55,500,829 (GRCm39) missense probably damaging 1.00
R1457:Lman2 UTSW 13 55,499,064 (GRCm39) missense probably benign 0.01
R1482:Lman2 UTSW 13 55,499,218 (GRCm39) missense possibly damaging 0.92
R2209:Lman2 UTSW 13 55,499,315 (GRCm39) missense probably damaging 0.99
R2347:Lman2 UTSW 13 55,500,812 (GRCm39) missense possibly damaging 0.91
R6132:Lman2 UTSW 13 55,510,038 (GRCm39) missense probably benign
R6297:Lman2 UTSW 13 55,496,244 (GRCm39) missense probably damaging 0.99
R6461:Lman2 UTSW 13 55,494,728 (GRCm39) missense probably damaging 1.00
R7148:Lman2 UTSW 13 55,500,762 (GRCm39) missense probably benign 0.04
R7422:Lman2 UTSW 13 55,499,338 (GRCm39) missense probably damaging 1.00
R7498:Lman2 UTSW 13 55,494,790 (GRCm39) missense probably damaging 1.00
R8826:Lman2 UTSW 13 55,510,368 (GRCm39) missense unknown
R8872:Lman2 UTSW 13 55,496,197 (GRCm39) missense probably benign 0.02
R9007:Lman2 UTSW 13 55,500,773 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAAGACTCTGGTCAGCAG -3'
(R):5'- CAGAGAGCCTAGAGACAGCATC -3'

Sequencing Primer
(F):5'- AAGACTCTGGTCAGCAGCAGTC -3'
(R):5'- CATCTGGGGCCGGTATCACTTAAG -3'
Posted On 2020-04-27