Incidental Mutation 'R7720:Lman2'
ID628521
Institutional Source Beutler Lab
Gene Symbol Lman2
Ensembl Gene ENSMUSG00000021484
Gene Namelectin, mannose-binding 2
Synonyms1300009F09Rik, 1110003H06Rik, VIP36, GP36B
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7720 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55343833-55362783 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 55353077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021940]
Predicted Effect probably null
Transcript: ENSMUST00000021940
SMART Domains Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
Pfam:Lectin_leg-like 54 280 6.6e-104 PFAM
transmembrane domain 325 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,102 C148S probably damaging Het
4921530L21Rik A G 14: 95,882,112 R102G probably benign Het
A230050P20Rik C T 9: 20,868,859 probably benign Het
Agap2 A G 10: 127,091,088 D1018G probably damaging Het
Atm T C 9: 53,522,239 N237S possibly damaging Het
Card6 G T 15: 5,098,423 Q1164K unknown Het
Cped1 G A 6: 22,222,431 C730Y probably damaging Het
Csmd1 A T 8: 15,931,108 L2770Q probably damaging Het
Ctsw T C 19: 5,467,044 T87A probably damaging Het
Dock4 T C 12: 40,806,975 I1269T probably damaging Het
F11 T C 8: 45,252,090 E138G possibly damaging Het
Fam124b A G 1: 80,200,257 S342P probably damaging Het
Fam71d T C 12: 78,712,133 S76P probably damaging Het
Gipr T C 7: 19,162,959 I129V probably benign Het
Gm5415 T C 1: 32,546,097 D244G probably benign Het
Gria4 A T 9: 4,464,288 V558D probably damaging Het
Gsdme C T 6: 50,229,308 G185E probably damaging Het
Hgd T A 16: 37,593,435 D86E probably benign Het
Hmcn1 T A 1: 150,646,709 H3480L probably benign Het
Hs2st1 T C 3: 144,454,022 N127D probably damaging Het
Ilf3 A G 9: 21,399,537 N599S possibly damaging Het
Itsn1 G A 16: 91,868,083 G1132R unknown Het
Jakmip2 A G 18: 43,571,908 S343P possibly damaging Het
Kif1b A G 4: 149,182,355 V1670A probably benign Het
Ltbp1 A T 17: 75,385,124 Y1579F probably damaging Het
Mon2 G A 10: 123,032,588 A520V probably benign Het
Mrpl10 T G 11: 97,047,537 V171G possibly damaging Het
Mrps27 A T 13: 99,401,330 T153S unknown Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nlrp10 A G 7: 108,924,488 V595A probably benign Het
Nol4 A T 18: 23,040,023 M7K probably benign Het
Oasl1 G A 5: 114,929,921 S188N probably damaging Het
Olfr193 T C 16: 59,109,771 I280V probably benign Het
Olfr709-ps1 C A 7: 106,927,411 G16V probably benign Het
Pcdhga2 A G 18: 37,669,940 Y279C probably damaging Het
Pfpl C T 19: 12,429,174 A263V probably benign Het
Phf3 T G 1: 30,829,857 K703N probably damaging Het
Pik3ca C G 3: 32,436,218 P5A probably damaging Het
Plekha6 T C 1: 133,293,707 V987A probably damaging Het
Ppp3ca T A 3: 136,890,489 I305N probably damaging Het
Prex2 A G 1: 11,181,937 K1069E possibly damaging Het
Prss50 T C 9: 110,861,335 V182A probably damaging Het
Ptprg A G 14: 12,211,703 N995S probably benign Het
Robo2 C A 16: 73,897,015 G1375V probably benign Het
Rtl1 T C 12: 109,594,430 Y325C possibly damaging Het
Shcbp1 A C 8: 4,748,720 S400A probably damaging Het
Sirpb1c T A 3: 15,832,072 Y380F probably benign Het
Tbl2 G C 5: 135,159,475 L374F probably damaging Het
Tpr C A 1: 150,429,532 A1524E possibly damaging Het
Vmn2r45 T A 7: 8,483,461 E276V probably damaging Het
Vps16 C T 2: 130,441,703 Q606* probably null Het
Vstm5 A T 9: 15,239,356 Q29L probably benign Het
Wipi1 G T 11: 109,582,423 S250Y probably damaging Het
Other mutations in Lman2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lman2 APN 13 55351242 missense possibly damaging 0.91
IGL02381:Lman2 APN 13 55351469 missense possibly damaging 0.77
R0331:Lman2 UTSW 13 55353016 missense probably damaging 1.00
R1457:Lman2 UTSW 13 55351251 missense probably benign 0.01
R1482:Lman2 UTSW 13 55351405 missense possibly damaging 0.92
R2209:Lman2 UTSW 13 55351502 missense probably damaging 0.99
R2347:Lman2 UTSW 13 55352999 missense possibly damaging 0.91
R6132:Lman2 UTSW 13 55362225 missense probably benign
R6297:Lman2 UTSW 13 55348431 missense probably damaging 0.99
R6461:Lman2 UTSW 13 55346915 missense probably damaging 1.00
R7148:Lman2 UTSW 13 55352949 missense probably benign 0.04
R7422:Lman2 UTSW 13 55351525 missense probably damaging 1.00
R7498:Lman2 UTSW 13 55346977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGACTCTGGTCAGCAG -3'
(R):5'- CAGAGAGCCTAGAGACAGCATC -3'

Sequencing Primer
(F):5'- AAGACTCTGGTCAGCAGCAGTC -3'
(R):5'- CATCTGGGGCCGGTATCACTTAAG -3'
Posted On2020-04-27