Incidental Mutation 'RF018:Pgm2'
ID628530
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #RF018 (G1)
Quality Score63.0073
Status Validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationsplice site (113 bp from exon)
DNA Base Change (assembly) A to T at 99962303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect probably null
Transcript: ENSMUST00000058351
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102783
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,762,166 probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,042,253 probably benign Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,390,232 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,627,578 probably benign Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,608,929 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,677,283 probably null Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense not run
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCGAAGAATATGCCATTTGCC -3'
(R):5'- TCCTCTAGGCAAGGCTATTGTG -3'

Sequencing Primer
(F):5'- CATTTGCCCTGACTTGAAGGTAGAC -3'
(R):5'- CTCTAGGCAAGGCTATTGTGGAAAC -3'
Posted On2020-04-28