Incidental Mutation 'R7770:Dnah7c'
ID 628539
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R7770 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation splice site (153 bp from exon)
DNA Base Change (assembly) A to T at 46626300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178395] [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000178395
SMART Domains Protein: ENSMUSP00000136771
Gene: ENSMUSG00000101337

DomainStartEndE-ValueType
Pfam:AAA_6 1 204 5.4e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189749
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCCCAGCATCACTATGACTATG -3'
(R):5'- ACGTAGTGATGATGTTCAGGGG -3'

Sequencing Primer
(F):5'- CCAGCATCACTATGACTATGGGATG -3'
(R):5'- AGTGATGATGTTCAGGGGTTTCTATG -3'
Posted On 2020-04-28