Incidental Mutation 'R7770:Prmt9'
ID628540
Institutional Source Beutler Lab
Gene Symbol Prmt9
Ensembl Gene ENSMUSG00000037134
Gene Nameprotein arginine methyltransferase 9
SynonymsPrmt10
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R7770 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location77549397-77581338 bp(+) (GRCm38)
Type of Mutationintron (70 bp from exon)
DNA Base Change (assembly) T to A at 77559185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056237] [ENSMUST00000118622] [ENSMUST00000210040]
Predicted Effect probably null
Transcript: ENSMUST00000056237
SMART Domains Protein: ENSMUSP00000050181
Gene: ENSMUSG00000037134

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_11 67 132 1.2e-7 PFAM
Pfam:TPR_2 102 134 7.9e-5 PFAM
Pfam:PrmA 168 257 2.5e-10 PFAM
internal_repeat_1 585 836 1.37e-10 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000118622
SMART Domains Protein: ENSMUSP00000112692
Gene: ENSMUSG00000037134

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:TPR_2 102 134 3e-5 PFAM
Pfam:PrmA 168 257 4.9e-10 PFAM
internal_repeat_1 585 836 1.05e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000210040
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Prmt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Prmt9 APN 8 77562440 missense probably damaging 1.00
IGL02306:Prmt9 APN 8 77560818 missense probably benign 0.06
IGL02971:Prmt9 APN 8 77565069 missense probably benign 0.00
1mM(1):Prmt9 UTSW 8 77555764 missense probably benign 0.01
R0004:Prmt9 UTSW 8 77555782 missense possibly damaging 0.81
R0928:Prmt9 UTSW 8 77581176 missense probably damaging 1.00
R1328:Prmt9 UTSW 8 77572654 missense possibly damaging 0.86
R1777:Prmt9 UTSW 8 77565108 missense probably benign 0.05
R1826:Prmt9 UTSW 8 77555674 nonsense probably null
R1925:Prmt9 UTSW 8 77577339 missense possibly damaging 0.52
R3855:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R3856:Prmt9 UTSW 8 77568265 missense probably benign 0.22
R4089:Prmt9 UTSW 8 77572545 missense probably benign 0.00
R4963:Prmt9 UTSW 8 77555729 missense probably damaging 1.00
R5196:Prmt9 UTSW 8 77564997 missense probably benign 0.30
R5413:Prmt9 UTSW 8 77572009 missense possibly damaging 0.95
R5975:Prmt9 UTSW 8 77561018 intron probably benign
R6271:Prmt9 UTSW 8 77577463 missense probably damaging 0.96
R7023:Prmt9 UTSW 8 77549457 start gained probably benign
R7107:Prmt9 UTSW 8 77568251 missense possibly damaging 0.62
R7159:Prmt9 UTSW 8 77555764 missense probably benign 0.01
R7209:Prmt9 UTSW 8 77564998 missense probably benign 0.32
R7819:Prmt9 UTSW 8 77568344 missense probably benign 0.11
X0027:Prmt9 UTSW 8 77560883 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGCTTAATGACACCAGGAGAAAC -3'
(R):5'- GGCTTTCTAGATTCCACCAGAATG -3'

Sequencing Primer
(F):5'- CCAGGAGAAACATGGTTTATAATGC -3'
(R):5'- TGGCTGTCCTGGAACTCAC -3'
Posted On2020-04-28