Incidental Mutation 'R7770:Tgfbi'
ID628542
Institutional Source Beutler Lab
Gene Symbol Tgfbi
Ensembl Gene ENSMUSG00000035493
Gene Nametransforming growth factor, beta induced
Synonyms68kDa, bIG-h3, Beta-ig
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7770 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location56609523-56639562 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 56632844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045173] [ENSMUST00000225600]
Predicted Effect probably null
Transcript: ENSMUST00000045173
SMART Domains Protein: ENSMUSP00000037719
Gene: ENSMUSG00000035493

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 139 239 1.35e-33 SMART
FAS1 276 374 6.75e-34 SMART
FAS1 411 501 1.16e-14 SMART
FAS1 538 635 6.75e-34 SMART
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. This protein plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. The protein is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in this gene are associated with multiple types of corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show delayed growth and are prone to spontaneous and induced tumors. Homozygotes for a second null allele are prone to STZ-induced diabetes and show impaired islet function under stress. Homozygotes for a third null allele show a transient decrease in retinal apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Tgfbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Tgfbi APN 13 56630595 missense probably benign 0.41
IGL02021:Tgfbi APN 13 56631353 missense probably damaging 1.00
IGL02325:Tgfbi APN 13 56631230 missense probably benign 0.00
PIT4486001:Tgfbi UTSW 13 56629794 missense probably damaging 0.98
R0008:Tgfbi UTSW 13 56629774 missense probably benign 0.00
R0122:Tgfbi UTSW 13 56627968 missense probably damaging 1.00
R0389:Tgfbi UTSW 13 56629702 missense probably benign 0.02
R0419:Tgfbi UTSW 13 56632193 splice site probably benign
R0432:Tgfbi UTSW 13 56632191 splice site probably benign
R0671:Tgfbi UTSW 13 56638726 missense probably null 1.00
R0825:Tgfbi UTSW 13 56638710 splice site probably benign
R1263:Tgfbi UTSW 13 56630655 missense probably damaging 1.00
R1597:Tgfbi UTSW 13 56632191 splice site probably benign
R1864:Tgfbi UTSW 13 56632881 missense probably benign 0.16
R1940:Tgfbi UTSW 13 56614314 missense possibly damaging 0.92
R2570:Tgfbi UTSW 13 56638708 splice site probably null
R3111:Tgfbi UTSW 13 56609734 missense probably damaging 1.00
R3613:Tgfbi UTSW 13 56625726 missense probably damaging 1.00
R4815:Tgfbi UTSW 13 56632120 missense probably benign 0.45
R5847:Tgfbi UTSW 13 56636605 missense possibly damaging 0.94
R6314:Tgfbi UTSW 13 56626163 missense probably benign 0.01
R6810:Tgfbi UTSW 13 56637203 missense probably benign
R6821:Tgfbi UTSW 13 56626137 missense possibly damaging 0.95
R6943:Tgfbi UTSW 13 56637176 missense possibly damaging 0.77
R7165:Tgfbi UTSW 13 56628016 missense probably damaging 0.99
R7297:Tgfbi UTSW 13 56632113 missense possibly damaging 0.74
R7910:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
R7991:Tgfbi UTSW 13 56632184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTCTGCTTACCAGGATC -3'
(R):5'- CCGAGAGACTGCCTTTTCAG -3'

Sequencing Primer
(F):5'- GCTTACCAGGATCACATGCTTAG -3'
(R):5'- GAGACTGCCTTTTCAGAACAGTG -3'
Posted On2020-04-28