Incidental Mutation 'R7770:Slc22a19'
ID628543
Institutional Source Beutler Lab
Gene Symbol Slc22a19
Ensembl Gene ENSMUSG00000024757
Gene Namesolute carrier family 22 (organic anion transporter), member 19
SynonymsOat5, D630043A20Rik, Slc22a9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7770 (G1)
Quality Score128.008
Status Validated
Chromosome19
Chromosomal Location7673061-7711310 bp(-) (GRCm38)
Type of Mutationintron (5638 bp from exon)
DNA Base Change (assembly) T to A at 7703995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025666]
Predicted Effect probably null
Transcript: ENSMUST00000025666
SMART Domains Protein: ENSMUSP00000025666
Gene: ENSMUSG00000024757

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sugar_tr 103 528 6.3e-22 PFAM
Pfam:MFS_1 122 378 2.4e-20 PFAM
Pfam:MFS_1 377 549 1.7e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A24 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Slc22a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Slc22a19 APN 19 7682958 missense probably benign 0.00
IGL01126:Slc22a19 APN 19 7674283 missense possibly damaging 0.65
IGL01349:Slc22a19 APN 19 7674427 missense probably benign 0.36
IGL01409:Slc22a19 APN 19 7711130 missense probably benign 0.00
IGL01529:Slc22a19 APN 19 7682935 missense probably damaging 0.97
IGL03382:Slc22a19 APN 19 7681862 missense probably benign 0.01
R0269:Slc22a19 UTSW 19 7709621 splice site probably benign
R0464:Slc22a19 UTSW 19 7682913 missense probably benign 0.44
R1866:Slc22a19 UTSW 19 7711141 missense probably damaging 1.00
R1975:Slc22a19 UTSW 19 7683859 splice site probably benign
R2184:Slc22a19 UTSW 19 7709661 missense probably benign
R2226:Slc22a19 UTSW 19 7683850 missense possibly damaging 0.92
R2894:Slc22a19 UTSW 19 7692804 missense probably benign 0.43
R4751:Slc22a19 UTSW 19 7691145 missense possibly damaging 0.65
R5016:Slc22a19 UTSW 19 7674372 missense probably benign 0.07
R5026:Slc22a19 UTSW 19 7674372 missense probably benign 0.07
R5108:Slc22a19 UTSW 19 7711171 missense probably benign
R5149:Slc22a19 UTSW 19 7711138 missense probably damaging 1.00
R5714:Slc22a19 UTSW 19 7711022 missense probably damaging 0.98
R6062:Slc22a19 UTSW 19 7674282 missense probably damaging 1.00
R6091:Slc22a19 UTSW 19 7711063 missense probably benign 0.26
R6982:Slc22a19 UTSW 19 7682969 missense probably benign 0.08
R7624:Slc22a19 UTSW 19 7673303 nonsense probably null
R7624:Slc22a19 UTSW 19 7693818 missense probably benign 0.44
R7678:Slc22a19 UTSW 19 7710937 missense possibly damaging 0.88
R7743:Slc22a19 UTSW 19 7683836 missense possibly damaging 0.74
X0026:Slc22a19 UTSW 19 7710858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAAATTCTAGTCACCCTGGTC -3'
(R):5'- CATCATTTGGAGCGGGAGAG -3'

Sequencing Primer
(F):5'- GACAGATGCCATTTTCCC -3'
(R):5'- GGCAGAGGAGTTGGGACGC -3'
Posted On2020-04-28