Incidental Mutation 'R7771:Tmprss11b'
ID628567
Institutional Source Beutler Lab
Gene Symbol Tmprss11b
Ensembl Gene ENSMUSG00000035861
Gene Nametransmembrane protease, serine 11B
SynonymsTmprss11bnl, 9930019B18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86657631-86676362 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86661695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038448]
Predicted Effect probably null
Transcript: ENSMUST00000038448
SMART Domains Protein: ENSMUSP00000042406
Gene: ENSMUSG00000035861

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:SEA 46 148 2.3e-26 PFAM
Tryp_SPc 184 410 6.19e-89 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Tmprss11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Tmprss11b APN 5 86663517 missense probably benign
IGL02340:Tmprss11b APN 5 86662231 missense probably benign
IGL02500:Tmprss11b APN 5 86667323 critical splice donor site probably null
demolished UTSW 5 86664314 missense probably damaging 1.00
R0356:Tmprss11b UTSW 5 86660467 makesense probably null
R0506:Tmprss11b UTSW 5 86661640 missense probably damaging 1.00
R0528:Tmprss11b UTSW 5 86671894 missense probably damaging 1.00
R1424:Tmprss11b UTSW 5 86664973 missense probably benign 0.09
R1471:Tmprss11b UTSW 5 86660496 missense possibly damaging 0.76
R1554:Tmprss11b UTSW 5 86661631 missense probably benign 0.01
R3436:Tmprss11b UTSW 5 86667584 nonsense probably null
R3829:Tmprss11b UTSW 5 86661590 missense probably damaging 0.98
R4409:Tmprss11b UTSW 5 86664278 missense probably benign 0.26
R4495:Tmprss11b UTSW 5 86665063 nonsense probably null
R4624:Tmprss11b UTSW 5 86665036 missense probably benign 0.04
R4834:Tmprss11b UTSW 5 86663559 missense probably damaging 1.00
R5436:Tmprss11b UTSW 5 86662233 missense probably benign 0.10
R5812:Tmprss11b UTSW 5 86665098 missense possibly damaging 0.67
R6262:Tmprss11b UTSW 5 86662260 missense probably benign 0.07
R6882:Tmprss11b UTSW 5 86671671 intron probably null
R6893:Tmprss11b UTSW 5 86663386 critical splice donor site probably null
R7312:Tmprss11b UTSW 5 86664314 missense probably damaging 1.00
R8101:Tmprss11b UTSW 5 86664962 critical splice donor site probably null
X0067:Tmprss11b UTSW 5 86662200 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86660541 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86661613 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTGAATGGTTTCCAGGCTTACC -3'
(R):5'- GGCAACATTTGAAAGGTGTTTC -3'

Sequencing Primer
(F):5'- TTACCTGGCAAGCATCGATACTG -3'
(R):5'- TTCATTAGTTTGGGGGCAAGAGAAAC -3'
Posted On2020-05-05