Incidental Mutation 'R7771:Vmn2r98'
ID 628568
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R7771 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 19067198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424] [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably null
Transcript: ENSMUST00000170424
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170424
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTTGGACACTGTTGCTCTG -3'
(R):5'- TTGACCCTGGGGAGCATTTG -3'

Sequencing Primer
(F):5'- GGACACTGTTGCTCTGAACATATTC -3'
(R):5'- AGCATTTGCAGAAAAGGATCC -3'
Posted On 2020-05-05