Incidental Mutation 'R7793:Cep89'
ID628575
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35429928 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 630 (R630H)
Ref Sequence ENSEMBL: ENSMUSP00000121393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141704
AA Change: R630H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: R630H

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150421
SMART Domains Protein: ENSMUSP00000121422
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
coiled coil region 77 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4414:Cep89 UTSW 7 35416397 unclassified probably benign
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6361:Cep89 UTSW 7 35398047 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
R7340:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7341:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7347:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7348:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7365:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7366:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7394:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7399:Cep89 UTSW 7 35438378 missense probably damaging 1.00
R7422:Cep89 UTSW 7 35428247 missense probably damaging 1.00
R7792:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7819:Cep89 UTSW 7 35432543 missense probably benign 0.07
R7860:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
R7899:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7943:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Z1177:Cep89 UTSW 7 35397081 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGACAATCACAGGCCATGC -3'
(R):5'- AGAAGGCTTGTAAGAAACATCACC -3'

Sequencing Primer
(F):5'- AATCACAGGCCATGCTGGGG -3'
(R):5'- CTTGTAAGAAACATCACCTGGAAGTC -3'
Posted On2020-05-11