Incidental Mutation 'R7801:Hdlbp'
List |< first << previous [record 17 of 47] next >> last >|
ID628582
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 93430307 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164] [ENSMUST00000188988] [ENSMUST00000190321]
Predicted Effect probably null
Transcript: ENSMUST00000042498
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170883
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186164
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188988
SMART Domains Protein: ENSMUSP00000140946
Gene: ENSMUSG00000034088

DomainStartEndE-ValueType
Blast:KH 74 148 2e-28 BLAST
Pfam:KH_1 152 177 2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190321
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1331:Hdlbp UTSW 1 93421131 missense probably damaging 1.00
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R1985:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5196:Hdlbp UTSW 1 93420193 missense probably damaging 1.00
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6428:Hdlbp UTSW 1 93431445 missense possibly damaging 0.91
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R7156:Hdlbp UTSW 1 93413915 missense probably damaging 1.00
R7391:Hdlbp UTSW 1 93431061 missense possibly damaging 0.93
R7457:Hdlbp UTSW 1 93428222 missense probably benign 0.04
R7498:Hdlbp UTSW 1 93413615 missense probably benign 0.00
R7554:Hdlbp UTSW 1 93437309 missense probably damaging 0.96
R7593:Hdlbp UTSW 1 93430283 missense probably benign 0.01
R7672:Hdlbp UTSW 1 93437099 missense possibly damaging 0.90
R7904:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R8062:Hdlbp UTSW 1 93438342 missense probably benign 0.10
R8113:Hdlbp UTSW 1 93417195 missense probably damaging 0.98
RF020:Hdlbp UTSW 1 93440734 missense probably benign
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCAGTCAACGCCTGTCC -3'
(R):5'- CAAATGGAAAACAGTCTGGTTACTC -3'

Sequencing Primer
(F):5'- AACGCCTGTCCCAACTTTTCAG -3'
(R):5'- GTTACTCAAAAAGTGACCAGACTCTG -3'
Posted On2020-05-12