Incidental Mutation 'R7808:Adgb'
ID628587
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7808 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 10378659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172530
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179956
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208717
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,444,594 probably benign Het
1700113H08Rik T C 10: 87,121,435 V11A probably benign Het
Abca12 A T 1: 71,274,634 probably null Het
Abcc12 T A 8: 86,507,939 M1232L probably benign Het
Adamts1 T C 16: 85,800,229 Y314C probably damaging Het
Ankrd12 T A 17: 65,985,653 K928N possibly damaging Het
Ano5 A T 7: 51,587,795 K789I possibly damaging Het
Cacna1d G T 14: 30,111,069 N938K probably damaging Het
Camk1g T C 1: 193,350,285 R273G possibly damaging Het
Caprin2 C A 6: 148,843,030 V966F probably damaging Het
Card6 T C 15: 5,099,472 H814R probably benign Het
Ccdc84 T C 9: 44,412,918 Q228R probably null Het
Cflar A G 1: 58,711,581 probably benign Het
Cftr T A 6: 18,204,205 N66K probably benign Het
Clasrp C T 7: 19,588,746 probably null Het
Clec4a4 T C 6: 122,990,380 I5T probably damaging Het
Cmtr2 T C 8: 110,221,619 I187T possibly damaging Het
Cnga1 A T 5: 72,604,273 F633I possibly damaging Het
Col16a1 C T 4: 130,073,264 P909S unknown Het
Csf1 C A 3: 107,760,045 A7S possibly damaging Het
Dhx30 A T 9: 110,086,202 V833D probably benign Het
Dlg2 T G 7: 92,431,055 I712M probably benign Het
Dmxl1 T A 18: 49,878,315 F1180I probably benign Het
Dnah9 T A 11: 66,005,805 K2398* probably null Het
Dus1l C T 11: 120,789,436 G471D possibly damaging Het
Dync1h1 A T 12: 110,655,459 N3412I possibly damaging Het
Dync1i2 T A 2: 71,250,834 probably null Het
Dysf T C 6: 84,070,929 S333P possibly damaging Het
Eed A T 7: 89,956,333 N349K probably benign Het
Eipr1 A T 12: 28,766,770 probably null Het
Fam160a2 G A 7: 105,384,525 R509C probably damaging Het
Fbxw16 A C 9: 109,448,154 V40G probably damaging Het
Fgfr4 A C 13: 55,161,156 R363S possibly damaging Het
Fgl2 A T 5: 21,373,231 N172I possibly damaging Het
Gabbr2 T A 4: 46,875,744 H126L possibly damaging Het
Gcnt2 A T 13: 40,860,862 N170Y possibly damaging Het
Gpt A G 15: 76,698,893 probably null Het
Igsf10 A G 3: 59,328,068 I1564T probably benign Het
Il22ra1 C A 4: 135,750,796 Q393K possibly damaging Het
Inpp5d A T 1: 87,683,845 K340* probably null Het
Jcad A G 18: 4,673,113 K292E probably damaging Het
Krt5 T A 15: 101,709,018 T427S probably benign Het
Krt76 T C 15: 101,890,494 D252G probably damaging Het
Krtap26-1 A G 16: 88,647,310 V141A not run Het
Lce6a A T 3: 92,620,335 V55D probably benign Het
Lpxn C T 19: 12,824,821 S170F possibly damaging Het
Magi2 T C 5: 20,465,840 V394A probably benign Het
Mbnl1 G A 3: 60,614,821 probably null Het
Med16 T A 10: 79,898,418 K554M probably damaging Het
Mettl14 T C 3: 123,372,585 D276G possibly damaging Het
Mphosph9 T C 5: 124,260,946 D1002G probably damaging Het
Mroh9 T C 1: 163,039,109 E686G probably damaging Het
Nav1 T C 1: 135,452,248 Y1512C unknown Het
Neb T C 2: 52,192,023 Y5712C probably damaging Het
Nek7 T A 1: 138,561,771 probably benign Het
Nptx1 T A 11: 119,544,636 I285F probably damaging Het
Oas1d G T 5: 120,914,971 E30* probably null Het
Olfr404-ps1 A T 11: 74,239,899 I112F probably damaging Het
Olfr429 C A 1: 174,089,851 Y270* probably null Het
Olfr577 A G 7: 102,973,110 V294A possibly damaging Het
Parp4 T G 14: 56,635,748 S1150A possibly damaging Het
Pinx1 A T 14: 63,919,292 K223* probably null Het
Plekha5 T C 6: 140,583,914 L1034S probably damaging Het
Ppp4r3a A G 12: 101,053,496 V400A possibly damaging Het
Prtg A T 9: 72,842,697 I128F possibly damaging Het
Rars T C 11: 35,828,707 E96G probably benign Het
Rhpn1 T A 15: 75,713,450 S551T probably benign Het
Selenow C T 7: 15,922,251 probably null Het
Serpina9 A T 12: 104,001,225 probably null Het
Shank3 A T 15: 89,548,880 D1276V probably damaging Het
Slc17a2 A C 13: 23,819,334 H285P probably damaging Het
Slc27a6 A G 18: 58,609,195 T494A probably damaging Het
Slc6a21 A C 7: 45,282,936 T54P Het
Syne2 A G 12: 75,983,727 probably null Het
Tal1 T C 4: 115,068,292 V186A probably benign Het
Tarsl2 A G 7: 65,652,261 K178E probably benign Het
Tex10 T A 4: 48,459,984 I456L probably benign Het
Tfcp2 A G 15: 100,522,429 F175S probably damaging Het
Timp2 C T 11: 118,303,800 A188T probably damaging Het
Tmc5 T A 7: 118,669,217 I836N probably damaging Het
Tmem100 T A 11: 90,035,476 M43K probably benign Het
Ulk2 A G 11: 61,854,552 Y9H probably damaging Het
Usp7 T C 16: 8,705,163 K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 T127I probably benign Het
Vmn2r28 T C 7: 5,493,679 Y58C probably damaging Het
Wdr55 G A 18: 36,760,416 G44S probably benign Het
Zfp677 C A 17: 21,397,385 H235N probably damaging Het
Zfp869 T A 8: 69,706,986 R312S probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 splice site probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 splice site probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
R8158:Adgb UTSW 10 10378734 missense probably benign 0.22
R8386:Adgb UTSW 10 10350304 missense probably damaging 1.00
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTAAAGAATAAAAGCAGGATCTCGTG -3'
(R):5'- GGCACAGTCTATTACAATCCAGG -3'

Sequencing Primer
(F):5'- AATAAAAGCAGGATCTCGTGTATAAG -3'
(R):5'- AGTCTATTACAATCCAGGTCCGC -3'
Posted On2020-05-12