Incidental Mutation 'R7808:Adgb'
ID 628587
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Name androglobin
Synonyms 9130014G24Rik
MMRRC Submission 045863-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7808 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 10211447-10348070 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 10254403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
AlphaFold G3UZ78
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172530
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179956
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208717
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 86,957,297 (GRCm39) V11A probably benign Het
Abca12 A T 1: 71,313,793 (GRCm39) probably null Het
Abcc12 T A 8: 87,234,568 (GRCm39) M1232L probably benign Het
Adamts1 T C 16: 85,597,117 (GRCm39) Y314C probably damaging Het
Ankrd12 T A 17: 66,292,648 (GRCm39) K928N possibly damaging Het
Ano5 A T 7: 51,237,543 (GRCm39) K789I possibly damaging Het
Cacna1d G T 14: 29,833,026 (GRCm39) N938K probably damaging Het
Camk1g T C 1: 193,032,593 (GRCm39) R273G possibly damaging Het
Caprin2 C A 6: 148,744,528 (GRCm39) V966F probably damaging Het
Card6 T C 15: 5,128,954 (GRCm39) H814R probably benign Het
Cenatac T C 9: 44,324,215 (GRCm39) Q228R probably null Het
Cflar A G 1: 58,750,740 (GRCm39) probably benign Het
Cftr T A 6: 18,204,204 (GRCm39) N66K probably benign Het
Clasrp C T 7: 19,322,671 (GRCm39) probably null Het
Clec4a4 T C 6: 122,967,339 (GRCm39) I5T probably damaging Het
Cmtr2 T C 8: 110,948,251 (GRCm39) I187T possibly damaging Het
Cnga1 A T 5: 72,761,616 (GRCm39) F633I possibly damaging Het
Col16a1 C T 4: 129,967,057 (GRCm39) P909S unknown Het
Csf1 C A 3: 107,667,361 (GRCm39) A7S possibly damaging Het
Cstpp1 T C 2: 91,274,939 (GRCm39) probably benign Het
Dhx30 A T 9: 109,915,270 (GRCm39) V833D probably benign Het
Dlg2 T G 7: 92,080,263 (GRCm39) I712M probably benign Het
Dmxl1 T A 18: 50,011,382 (GRCm39) F1180I probably benign Het
Dnah9 T A 11: 65,896,631 (GRCm39) K2398* probably null Het
Dus1l C T 11: 120,680,262 (GRCm39) G471D possibly damaging Het
Dync1h1 A T 12: 110,621,893 (GRCm39) N3412I possibly damaging Het
Dync1i2 T A 2: 71,081,178 (GRCm39) probably null Het
Dysf T C 6: 84,047,911 (GRCm39) S333P possibly damaging Het
Eed A T 7: 89,605,541 (GRCm39) N349K probably benign Het
Eipr1 A T 12: 28,816,769 (GRCm39) probably null Het
Fbxw16 A C 9: 109,277,222 (GRCm39) V40G probably damaging Het
Fgfr4 A C 13: 55,308,969 (GRCm39) R363S possibly damaging Het
Fgl2 A T 5: 21,578,229 (GRCm39) N172I possibly damaging Het
Fhip1b G A 7: 105,033,732 (GRCm39) R509C probably damaging Het
Gabbr2 T A 4: 46,875,744 (GRCm39) H126L possibly damaging Het
Gcnt2 A T 13: 41,014,338 (GRCm39) N170Y possibly damaging Het
Gpt A G 15: 76,583,093 (GRCm39) probably null Het
Igsf10 A G 3: 59,235,489 (GRCm39) I1564T probably benign Het
Il22ra1 C A 4: 135,478,107 (GRCm39) Q393K possibly damaging Het
Inpp5d A T 1: 87,611,567 (GRCm39) K340* probably null Het
Jcad A G 18: 4,673,113 (GRCm39) K292E probably damaging Het
Krt5 T A 15: 101,617,453 (GRCm39) T427S probably benign Het
Krt76 T C 15: 101,798,929 (GRCm39) D252G probably damaging Het
Krtap26-1 A G 16: 88,444,198 (GRCm39) V141A not run Het
Lce6a A T 3: 92,527,642 (GRCm39) V55D probably benign Het
Lpxn C T 19: 12,802,185 (GRCm39) S170F possibly damaging Het
Magi2 T C 5: 20,670,838 (GRCm39) V394A probably benign Het
Mbnl1 G A 3: 60,522,242 (GRCm39) probably null Het
Med16 T A 10: 79,734,252 (GRCm39) K554M probably damaging Het
Mettl14 T C 3: 123,166,234 (GRCm39) D276G possibly damaging Het
Mphosph9 T C 5: 124,399,009 (GRCm39) D1002G probably damaging Het
Mroh9 T C 1: 162,866,678 (GRCm39) E686G probably damaging Het
Nav1 T C 1: 135,379,986 (GRCm39) Y1512C unknown Het
Neb T C 2: 52,082,035 (GRCm39) Y5712C probably damaging Het
Nek7 T A 1: 138,489,509 (GRCm39) probably benign Het
Nptx1 T A 11: 119,435,462 (GRCm39) I285F probably damaging Het
Oas1d G T 5: 121,053,034 (GRCm39) E30* probably null Het
Or1p1b A T 11: 74,130,725 (GRCm39) I112F probably damaging Het
Or51g2 A G 7: 102,622,317 (GRCm39) V294A possibly damaging Het
Or6n1 C A 1: 173,917,417 (GRCm39) Y270* probably null Het
Parp4 T G 14: 56,873,205 (GRCm39) S1150A possibly damaging Het
Pinx1 A T 14: 64,156,741 (GRCm39) K223* probably null Het
Plekha5 T C 6: 140,529,640 (GRCm39) L1034S probably damaging Het
Ppp4r3a A G 12: 101,019,755 (GRCm39) V400A possibly damaging Het
Prtg A T 9: 72,749,979 (GRCm39) I128F possibly damaging Het
Rars1 T C 11: 35,719,534 (GRCm39) E96G probably benign Het
Rhpn1 T A 15: 75,585,299 (GRCm39) S551T probably benign Het
Selenow C T 7: 15,656,176 (GRCm39) probably null Het
Serpina9 A T 12: 103,967,484 (GRCm39) probably null Het
Shank3 A T 15: 89,433,083 (GRCm39) D1276V probably damaging Het
Slc27a6 A G 18: 58,742,267 (GRCm39) T494A probably damaging Het
Slc34a1 A C 13: 24,003,317 (GRCm39) H285P probably damaging Het
Slc6a21 A C 7: 44,932,360 (GRCm39) T54P Het
Syne2 A G 12: 76,030,501 (GRCm39) probably null Het
Tal1 T C 4: 114,925,489 (GRCm39) V186A probably benign Het
Tars3 A G 7: 65,302,009 (GRCm39) K178E probably benign Het
Tex10 T A 4: 48,459,984 (GRCm39) I456L probably benign Het
Tfcp2 A G 15: 100,420,310 (GRCm39) F175S probably damaging Het
Timp2 C T 11: 118,194,626 (GRCm39) A188T probably damaging Het
Tmc5 T A 7: 118,268,440 (GRCm39) I836N probably damaging Het
Tmem100 T A 11: 89,926,302 (GRCm39) M43K probably benign Het
Ulk2 A G 11: 61,745,378 (GRCm39) Y9H probably damaging Het
Usp7 T C 16: 8,523,027 (GRCm39) K311E probably damaging Het
Vmn1r238 G A 18: 3,123,033 (GRCm39) T127I probably benign Het
Vmn2r28 T C 7: 5,496,678 (GRCm39) Y58C probably damaging Het
Wdr55 G A 18: 36,893,469 (GRCm39) G44S probably benign Het
Zfp677 C A 17: 21,617,647 (GRCm39) H235N probably damaging Het
Zfp869 T A 8: 70,159,636 (GRCm39) R312S probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10,281,843 (GRCm39) missense possibly damaging 0.87
IGL01083:Adgb APN 10 10,283,298 (GRCm39) missense possibly damaging 0.50
IGL03064:Adgb APN 10 10,276,316 (GRCm39) missense probably benign 0.02
R0080:Adgb UTSW 10 10,253,583 (GRCm39) splice site probably benign
R0084:Adgb UTSW 10 10,272,088 (GRCm39) missense possibly damaging 0.74
R0112:Adgb UTSW 10 10,282,902 (GRCm39) splice site probably benign
R0348:Adgb UTSW 10 10,233,623 (GRCm39) missense probably benign
R0415:Adgb UTSW 10 10,306,811 (GRCm39) splice site probably null
R0633:Adgb UTSW 10 10,267,473 (GRCm39) missense probably benign 0.36
R1052:Adgb UTSW 10 10,318,357 (GRCm39) missense probably benign 0.29
R1248:Adgb UTSW 10 10,271,054 (GRCm39) missense probably damaging 0.98
R1278:Adgb UTSW 10 10,258,572 (GRCm39) missense probably damaging 1.00
R1568:Adgb UTSW 10 10,318,409 (GRCm39) nonsense probably null
R1647:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1648:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1663:Adgb UTSW 10 10,215,419 (GRCm39) missense possibly damaging 0.86
R1688:Adgb UTSW 10 10,226,061 (GRCm39) nonsense probably null
R1758:Adgb UTSW 10 10,302,349 (GRCm39) missense probably damaging 1.00
R1772:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R1850:Adgb UTSW 10 10,318,246 (GRCm39) missense probably damaging 1.00
R1959:Adgb UTSW 10 10,270,993 (GRCm39) missense probably benign 0.02
R1980:Adgb UTSW 10 10,309,242 (GRCm39) missense probably benign
R2179:Adgb UTSW 10 10,271,018 (GRCm39) missense possibly damaging 0.94
R2229:Adgb UTSW 10 10,311,795 (GRCm39) missense probably damaging 1.00
R2283:Adgb UTSW 10 10,253,635 (GRCm39) missense probably damaging 0.99
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2875:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2876:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2920:Adgb UTSW 10 10,265,987 (GRCm39) missense probably damaging 1.00
R2931:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R3722:Adgb UTSW 10 10,216,254 (GRCm39) missense probably benign 0.32
R3846:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R3877:Adgb UTSW 10 10,318,227 (GRCm39) critical splice donor site probably null
R4210:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4211:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4333:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R4448:Adgb UTSW 10 10,266,569 (GRCm39) missense probably benign 0.32
R4470:Adgb UTSW 10 10,274,695 (GRCm39) missense probably benign 0.02
R4624:Adgb UTSW 10 10,278,748 (GRCm39) missense probably benign 0.00
R4656:Adgb UTSW 10 10,281,050 (GRCm39) missense probably damaging 0.99
R4676:Adgb UTSW 10 10,302,454 (GRCm39) missense probably damaging 1.00
R4792:Adgb UTSW 10 10,274,647 (GRCm39) missense probably damaging 0.96
R4795:Adgb UTSW 10 10,233,616 (GRCm39) missense probably benign 0.01
R4858:Adgb UTSW 10 10,225,321 (GRCm39) missense probably damaging 1.00
R4985:Adgb UTSW 10 10,276,376 (GRCm39) missense possibly damaging 0.69
R5057:Adgb UTSW 10 10,233,722 (GRCm39) missense probably benign 0.11
R5157:Adgb UTSW 10 10,274,710 (GRCm39) missense probably damaging 1.00
R5209:Adgb UTSW 10 10,274,681 (GRCm39) missense possibly damaging 0.71
R5339:Adgb UTSW 10 10,318,350 (GRCm39) missense probably damaging 1.00
R5376:Adgb UTSW 10 10,222,307 (GRCm39) missense probably benign 0.09
R5426:Adgb UTSW 10 10,226,004 (GRCm39) missense probably benign 0.14
R5516:Adgb UTSW 10 10,306,901 (GRCm39) missense probably damaging 1.00
R5554:Adgb UTSW 10 10,216,217 (GRCm39) missense probably damaging 0.98
R5678:Adgb UTSW 10 10,307,070 (GRCm39) missense possibly damaging 0.83
R5707:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5708:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5891:Adgb UTSW 10 10,253,591 (GRCm39) nonsense probably null
R5928:Adgb UTSW 10 10,254,531 (GRCm39) missense probably damaging 1.00
R6005:Adgb UTSW 10 10,271,096 (GRCm39) missense probably damaging 1.00
R6017:Adgb UTSW 10 10,325,780 (GRCm39) missense probably damaging 1.00
R6049:Adgb UTSW 10 10,253,770 (GRCm39) missense probably damaging 1.00
R6118:Adgb UTSW 10 10,307,035 (GRCm39) missense probably damaging 1.00
R6175:Adgb UTSW 10 10,274,687 (GRCm39) missense possibly damaging 0.94
R6186:Adgb UTSW 10 10,298,502 (GRCm39) missense probably damaging 1.00
R6234:Adgb UTSW 10 10,228,824 (GRCm39) splice site probably null
R6383:Adgb UTSW 10 10,325,772 (GRCm39) missense probably damaging 1.00
R6522:Adgb UTSW 10 10,253,636 (GRCm39) nonsense probably null
R6639:Adgb UTSW 10 10,311,700 (GRCm39) missense possibly damaging 0.51
R6697:Adgb UTSW 10 10,281,870 (GRCm39) nonsense probably null
R6742:Adgb UTSW 10 10,287,593 (GRCm39) missense probably damaging 1.00
R6745:Adgb UTSW 10 10,265,941 (GRCm39) missense probably damaging 1.00
R6850:Adgb UTSW 10 10,270,318 (GRCm39) missense probably benign 0.39
R7128:Adgb UTSW 10 10,347,985 (GRCm39) missense probably benign 0.26
R7326:Adgb UTSW 10 10,276,318 (GRCm39) missense possibly damaging 0.80
R7386:Adgb UTSW 10 10,253,693 (GRCm39) missense possibly damaging 0.52
R7431:Adgb UTSW 10 10,267,699 (GRCm39) splice site probably null
R7569:Adgb UTSW 10 10,306,996 (GRCm39) missense probably benign
R7579:Adgb UTSW 10 10,286,562 (GRCm39) nonsense probably null
R7582:Adgb UTSW 10 10,266,565 (GRCm39) missense probably damaging 1.00
R7615:Adgb UTSW 10 10,311,754 (GRCm39) missense probably damaging 0.96
R7692:Adgb UTSW 10 10,287,456 (GRCm39) critical splice donor site probably null
R7774:Adgb UTSW 10 10,215,404 (GRCm39) nonsense probably null
R8158:Adgb UTSW 10 10,254,478 (GRCm39) missense probably benign 0.22
R8386:Adgb UTSW 10 10,226,048 (GRCm39) missense probably damaging 1.00
R8746:Adgb UTSW 10 10,281,028 (GRCm39) critical splice donor site probably null
R8785:Adgb UTSW 10 10,233,710 (GRCm39) missense probably damaging 1.00
R9089:Adgb UTSW 10 10,318,432 (GRCm39) missense probably benign 0.26
R9140:Adgb UTSW 10 10,216,263 (GRCm39) nonsense probably null
R9386:Adgb UTSW 10 10,274,708 (GRCm39) missense probably benign 0.00
R9777:Adgb UTSW 10 10,283,214 (GRCm39) missense possibly damaging 0.74
X0003:Adgb UTSW 10 10,270,374 (GRCm39) missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10,254,486 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTAAAGAATAAAAGCAGGATCTCGTG -3'
(R):5'- GGCACAGTCTATTACAATCCAGG -3'

Sequencing Primer
(F):5'- AATAAAAGCAGGATCTCGTGTATAAG -3'
(R):5'- AGTCTATTACAATCCAGGTCCGC -3'
Posted On 2020-05-12