Incidental Mutation 'R7802:Palb2'
ID628597
Institutional Source Beutler Lab
Gene Symbol Palb2
Ensembl Gene ENSMUSG00000044702
Gene Namepartner and localizer of BRCA2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location122107262-122132985 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 122110896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000131657] [ENSMUST00000142952]
Predicted Effect probably null
Transcript: ENSMUST00000063587
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098068
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably null
Transcript: ENSMUST00000106469
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131657
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality with impaired inner cell mass proliferation, impaired gastrulation, absence of the amnion, somites and tail bud, and general improper organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Palb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Palb2 APN 7 122121048 splice site probably benign
IGL00232:Palb2 APN 7 122121064 missense probably damaging 0.99
IGL02171:Palb2 APN 7 122107586 missense probably damaging 1.00
IGL03030:Palb2 APN 7 122113256 missense probably damaging 1.00
IGL03102:Palb2 APN 7 122124499 missense possibly damaging 0.88
R0128:Palb2 UTSW 7 122128166 nonsense probably null
R1192:Palb2 UTSW 7 122128209 missense probably benign 0.11
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1575:Palb2 UTSW 7 122110838 splice site probably null
R1664:Palb2 UTSW 7 122124392 utr 3 prime probably benign
R1852:Palb2 UTSW 7 122114314 missense possibly damaging 0.93
R1984:Palb2 UTSW 7 122127080 missense probably damaging 0.96
R2061:Palb2 UTSW 7 122124525 missense possibly damaging 0.86
R2121:Palb2 UTSW 7 122127781 missense possibly damaging 0.61
R2877:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R2878:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R3923:Palb2 UTSW 7 122117360 splice site probably null
R4609:Palb2 UTSW 7 122124723 missense probably benign 0.16
R4629:Palb2 UTSW 7 122127966 missense possibly damaging 0.89
R4678:Palb2 UTSW 7 122127366 missense probably damaging 0.99
R5111:Palb2 UTSW 7 122117305 nonsense probably null
R5381:Palb2 UTSW 7 122128413 missense probably benign 0.06
R5470:Palb2 UTSW 7 122114351 missense probably damaging 1.00
R5793:Palb2 UTSW 7 122127637 missense probably benign 0.05
R6160:Palb2 UTSW 7 122128420 splice site probably null
R6630:Palb2 UTSW 7 122124529 missense probably damaging 0.97
R6783:Palb2 UTSW 7 122127488 missense probably damaging 1.00
R6897:Palb2 UTSW 7 122127047 critical splice donor site probably null
R7040:Palb2 UTSW 7 122114399 missense possibly damaging 0.88
R7121:Palb2 UTSW 7 122124834 missense probably benign 0.18
R7438:Palb2 UTSW 7 122117331 missense probably damaging 0.96
R7522:Palb2 UTSW 7 122113278 missense probably damaging 1.00
R7583:Palb2 UTSW 7 122127342 missense probably benign 0.15
R7679:Palb2 UTSW 7 122128014 missense probably benign 0.00
R7769:Palb2 UTSW 7 122128415 missense probably benign 0.11
R8271:Palb2 UTSW 7 122124874 missense probably damaging 0.99
X0060:Palb2 UTSW 7 122114478 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACCCTTGAAGAGCAGCAC -3'
(R):5'- CAGCCTTTTCCCAGTGGATG -3'

Sequencing Primer
(F):5'- ACACACTTACCTTCCAGCCTG -3'
(R):5'- TGGCACAAGGTGTATCTAAAGTATAG -3'
Posted On2020-05-18