Incidental Mutation 'R7802:Tgm4'
ID 628598
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms Eapa1, 9530008N10Rik, experimental autoimmune prostatitis antigen 1
MMRRC Submission 045857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7802 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 122863806-122896623 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 122880401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect silent
Transcript: ENSMUST00000026893
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect unknown
Transcript: ENSMUST00000217607
AA Change: S117G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T C 2: 31,650,438 (GRCm39) V12A probably benign Het
Bahcc1 T C 11: 120,165,518 (GRCm39) F983S probably benign Het
Cecr2 T C 6: 120,720,808 (GRCm39) I312T probably benign Het
Col6a2 A T 10: 76,439,632 (GRCm39) W711R probably damaging Het
Epb41l4a A G 18: 33,961,227 (GRCm39) F436L probably benign Het
Epha1 C T 6: 42,338,875 (GRCm39) R641Q possibly damaging Het
Ercc6 C A 14: 32,239,260 (GRCm39) A116E probably damaging Het
Ermard A G 17: 15,281,423 (GRCm39) E611G probably benign Het
Galnt16 T G 12: 80,628,021 (GRCm39) I239S probably damaging Het
Gna15 T C 10: 81,350,175 (GRCm39) R76G probably benign Het
Herc2 A G 7: 55,813,838 (GRCm39) Y2657C probably damaging Het
Mapkapk2 T C 1: 130,984,639 (GRCm39) I238V possibly damaging Het
Med13l T C 5: 118,866,655 (GRCm39) S570P probably benign Het
Mrap C T 16: 90,546,247 (GRCm39) T112M probably benign Het
Nadsyn1 T C 7: 143,359,763 (GRCm39) Q403R probably benign Het
Nostrin T C 2: 69,019,356 (GRCm39) V467A probably benign Het
Palb2 A T 7: 121,710,119 (GRCm39) probably null Het
Parp16 A G 9: 65,137,179 (GRCm39) N135S probably benign Het
Pcnt A T 10: 76,211,137 (GRCm39) probably null Het
Pde8b T C 13: 95,237,446 (GRCm39) D116G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Psmc5 T C 11: 106,152,538 (GRCm39) probably null Het
Rsf1 G T 7: 97,310,979 (GRCm39) V570F Het
Rundc3a A G 11: 102,290,835 (GRCm39) E306G probably benign Het
Serpinb6b C T 13: 33,155,579 (GRCm39) Het
Setx A G 2: 29,037,033 (GRCm39) T1173A probably benign Het
Slamf8 A G 1: 172,415,677 (GRCm39) S54P probably damaging Het
Slc5a2 A C 7: 127,870,970 (GRCm39) D570A possibly damaging Het
Slco5a1 T A 1: 13,060,700 (GRCm39) Q7L possibly damaging Het
Stt3b G T 9: 115,105,949 (GRCm39) S175R probably damaging Het
Taar6 T A 10: 23,861,151 (GRCm39) I132F probably benign Het
Tenm3 A G 8: 48,689,500 (GRCm39) V2029A probably damaging Het
Tmt1a A T 15: 100,203,182 (GRCm39) N152I possibly damaging Het
Togaram1 T A 12: 65,013,758 (GRCm39) C336* probably null Het
Ttn G A 2: 76,768,015 (GRCm39) T3028M unknown Het
Vmn2r25 A T 6: 123,828,791 (GRCm39) I161N possibly damaging Het
Vwf T C 6: 125,643,640 (GRCm39) C2394R Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 122,891,447 (GRCm39) unclassified probably benign
IGL01402:Tgm4 APN 9 122,880,519 (GRCm39) missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 122,885,531 (GRCm39) missense probably damaging 1.00
IGL02120:Tgm4 APN 9 122,875,594 (GRCm39) missense probably damaging 0.98
IGL03130:Tgm4 APN 9 122,885,580 (GRCm39) missense probably damaging 1.00
IGL03188:Tgm4 APN 9 122,874,101 (GRCm39) missense probably null 0.06
R0329:Tgm4 UTSW 9 122,877,622 (GRCm39) critical splice donor site probably null
R0480:Tgm4 UTSW 9 122,891,484 (GRCm39) missense probably benign
R0644:Tgm4 UTSW 9 122,880,523 (GRCm39) missense probably damaging 1.00
R0990:Tgm4 UTSW 9 122,875,576 (GRCm39) missense probably benign 0.02
R1604:Tgm4 UTSW 9 122,874,129 (GRCm39) missense probably benign 0.39
R1644:Tgm4 UTSW 9 122,880,481 (GRCm39) missense probably damaging 1.00
R2056:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2058:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2059:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2076:Tgm4 UTSW 9 122,880,160 (GRCm39) missense probably benign 0.24
R2437:Tgm4 UTSW 9 122,877,614 (GRCm39) nonsense probably null
R4392:Tgm4 UTSW 9 122,895,817 (GRCm39) missense probably benign 0.10
R4407:Tgm4 UTSW 9 122,885,595 (GRCm39) missense probably damaging 1.00
R4752:Tgm4 UTSW 9 122,880,451 (GRCm39) missense probably damaging 1.00
R5288:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5365:Tgm4 UTSW 9 122,895,866 (GRCm39) missense probably damaging 1.00
R5386:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5790:Tgm4 UTSW 9 122,890,808 (GRCm39) missense probably damaging 0.98
R5890:Tgm4 UTSW 9 122,890,703 (GRCm39) missense probably damaging 1.00
R6102:Tgm4 UTSW 9 122,885,600 (GRCm39) missense probably benign
R6358:Tgm4 UTSW 9 122,885,583 (GRCm39) missense probably damaging 1.00
R6956:Tgm4 UTSW 9 122,893,768 (GRCm39) missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 122,880,207 (GRCm39) missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 122,869,525 (GRCm39) missense probably damaging 1.00
R7258:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7313:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7369:Tgm4 UTSW 9 122,885,749 (GRCm39) critical splice donor site probably null
R8219:Tgm4 UTSW 9 122,874,117 (GRCm39) missense probably benign
R8787:Tgm4 UTSW 9 122,890,910 (GRCm39) missense probably damaging 1.00
R8936:Tgm4 UTSW 9 122,869,541 (GRCm39) missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 122,877,616 (GRCm39) missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 122,885,697 (GRCm39) missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9403:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9471:Tgm4 UTSW 9 122,869,444 (GRCm39) missense probably benign
R9746:Tgm4 UTSW 9 122,875,634 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTGTGGACCAGCAGTGTAC -3'
(R):5'- TCACAATTTGAACCAGTCTGC -3'

Sequencing Primer
(F):5'- TGGACCAGCAGTGTACCCATC -3'
(R):5'- TGAACCAGTCTGCAGAGAAGCTTC -3'
Posted On 2020-05-18