Incidental Mutation 'R7802:Tgm4'
ID628598
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 123051336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
Predicted Effect silent
Transcript: ENSMUST00000026893
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect unknown
Transcript: ENSMUST00000217607
AA Change: S117G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Galnt16 T G 12: 80,581,247 I239S probably damaging Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7369:Tgm4 UTSW 9 123056684 critical splice donor site probably null
R8219:Tgm4 UTSW 9 123045052 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTGGACCAGCAGTGTAC -3'
(R):5'- TCACAATTTGAACCAGTCTGC -3'

Sequencing Primer
(F):5'- TGGACCAGCAGTGTACCCATC -3'
(R):5'- TGAACCAGTCTGCAGAGAAGCTTC -3'
Posted On2020-05-18