Incidental Mutation 'R0717:Tmem201'
ID62860
Institutional Source Beutler Lab
Gene Symbol Tmem201
Ensembl Gene ENSMUSG00000044700
Gene Nametransmembrane protein 201
SynonymsSamp1, D4Ertd429e
MMRRC Submission 038899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R0717 (G1)
Quality Score114
Status Not validated
Chromosome4
Chromosomal Location149715375-149738044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149718810 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 534 (N534Y)
Ref Sequence ENSEMBL: ENSMUSP00000101312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054459] [ENSMUST00000105687]
Predicted Effect probably damaging
Transcript: ENSMUST00000054459
AA Change: N534Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050481
Gene: ENSMUSG00000044700
AA Change: N534Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.6e-43 PFAM
Pfam:DUF2448 191 392 4.4e-102 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105687
AA Change: N534Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101312
Gene: ENSMUSG00000044700
AA Change: N534Y

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.4e-39 PFAM
Pfam:DUF2448 191 389 3.1e-96 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
transmembrane domain 638 660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
Anxa11 G A 14: 25,874,789 probably null Het
Arhgap33 G T 7: 30,528,349 A475E probably damaging Het
Cacna1s A G 1: 136,098,291 N811S probably damaging Het
Cadm1 T A 9: 47,810,068 M252K probably benign Het
Cars T C 7: 143,584,755 R149G probably damaging Het
Ccdc125 A T 13: 100,690,358 D241V probably damaging Het
Col12a1 G A 9: 79,612,419 P2836S probably damaging Het
Grid2 T A 6: 64,666,275 I1007K possibly damaging Het
Hdhd2 G A 18: 76,951,204 A28T possibly damaging Het
Hivep1 A T 13: 42,154,946 T221S possibly damaging Het
Lztr1 A G 16: 17,516,048 probably null Het
Mbd1 C T 18: 74,273,597 A137V possibly damaging Het
Myh15 T C 16: 49,142,993 V1099A probably benign Het
Nox4 C A 7: 87,304,890 Y134* probably null Het
Olfr177 A G 16: 58,872,770 C127R probably damaging Het
Pde1c T A 6: 56,123,012 N681I probably damaging Het
Pon1 A G 6: 5,193,674 probably null Het
Prokr2 T C 2: 132,381,334 D96G probably damaging Het
Sdk2 C A 11: 113,832,326 V1280F probably damaging Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Tcaf1 A T 6: 42,678,665 M459K probably benign Het
Tspan9 A T 6: 127,966,380 probably null Het
Uba7 A T 9: 107,977,217 T252S probably benign Het
Ube2e2 T C 14: 18,888,435 T3A probably benign Het
Other mutations in Tmem201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tmem201 APN 4 149719588 splice site probably benign
R0508:Tmem201 UTSW 4 149731886 missense probably damaging 1.00
R1660:Tmem201 UTSW 4 149719575 missense probably damaging 1.00
R2138:Tmem201 UTSW 4 149718080 missense probably damaging 1.00
R2971:Tmem201 UTSW 4 149722445 splice site probably benign
R4430:Tmem201 UTSW 4 149731139 missense probably benign 0.03
R4704:Tmem201 UTSW 4 149727317 missense possibly damaging 0.77
R4876:Tmem201 UTSW 4 149722270 missense probably damaging 1.00
R4966:Tmem201 UTSW 4 149718687 missense probably benign
R4991:Tmem201 UTSW 4 149728155 missense possibly damaging 0.95
R5518:Tmem201 UTSW 4 149718077 missense probably benign
R5818:Tmem201 UTSW 4 149727392 missense probably benign 0.33
R7399:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8142:Tmem201 UTSW 4 149718657 missense probably benign
X0064:Tmem201 UTSW 4 149718071 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AAATGACCTCCAAGATGGGCCAAG -3'
(R):5'- TTCGTGAGCTGAGGGAATGCAC -3'

Sequencing Primer
(F):5'- AGTACCTACTGCGTGCTTCAG -3'
(R):5'- CActctctctctctctctctctctc -3'
Posted On2013-07-30