Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Clcn1'

628603

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, nmf355, NMF355, Clc-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7807 (G1)

Quality Score

76.0075

Status

Validated

Chromosome

Chromosomal Location

42286685-42315756 bp(+) (GRCm38)

Type of Mutation

splice site (175 bp from exon)

DNA Base Change (assembly)

A to G at 42310348 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]

Predicted Effect

probably benign
Transcript: ENSMUST00000031891

SMART Domains

Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	49	341	7.4e-128	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000031894

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095974

SMART Domains

Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	33	325	4.5e-128	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143278

SMART Domains

Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	61	353	1.9e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163235

SMART Domains

Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163936

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165780

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168660

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169024

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170028

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cdh13	T	A	8: 118,283,855	M1K	probably null	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42291703	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42310672	splice site	probably benign
IGL02055:Clcn1	APN	6	42307555	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42307073	splice site	probably benign
IGL02649:Clcn1	APN	6	42298829	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42286780	splice site	probably null
IGL03148:Clcn1	APN	6	42299991	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42290103	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42311219	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42311219	missense	probably benign	0.00
Faint	UTSW	6	42307265	missense	probably damaging	1.00
jack_spratt	UTSW	6	42310581	missense	probably benign
Limitations	UTSW	6	42310063	missense	possibly damaging	0.79
maimed	UTSW	6	42298820	missense	probably damaging	1.00
R0167:Clcn1	UTSW	6	42286836	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42310140	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42310581	missense	probably benign
R0573:Clcn1	UTSW	6	42313045	splice site	probably null
R0615:Clcn1	UTSW	6	42305575	missense	probably damaging	1.00
R0944:Clcn1	UTSW	6	42313141	missense	probably benign	0.00
R1562:Clcn1	UTSW	6	42300235	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42291440	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42313098	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42294145	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42298926	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42313991	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R1865:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42291625	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42313112	missense	probably damaging	0.99
R2987:Clcn1	UTSW	6	42298850	missense	probably damaging	1.00
R3082:Clcn1	UTSW	6	42290178	missense	probably damaging	0.98
R3500:Clcn1	UTSW	6	42292995	missense	probably damaging	0.99
R3747:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42309968	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42290197	splice site	probably null
R4836:Clcn1	UTSW	6	42309964	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42310988	nonsense	probably null
R5085:Clcn1	UTSW	6	42313880	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42300341	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42298889	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42307265	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42292966	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42300274	nonsense	probably null
R6175:Clcn1	UTSW	6	42314162	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42307590	missense	possibly damaging	0.84
R6394:Clcn1	UTSW	6	42313238	missense	possibly damaging	0.82
R7012:Clcn1	UTSW	6	42290608	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42298820	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42307543	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42291389	missense	possibly damaging	0.46
R7225:Clcn1	UTSW	6	42293462	missense	probably damaging	1.00
R7264:Clcn1	UTSW	6	42298838	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42291334	nonsense	probably null
R7663:Clcn1	UTSW	6	42310063	missense	possibly damaging	0.79
R7954:Clcn1	UTSW	6	42286691	unclassified	probably benign
R8026:Clcn1	UTSW	6	42307661	critical splice donor site	probably null
R8045:Clcn1	UTSW	6	42290694	missense	probably damaging	1.00
R8499:Clcn1	UTSW	6	42307199	missense	probably damaging	1.00
R8523:Clcn1	UTSW	6	42307589	nonsense	probably null
R8677:Clcn1	UTSW	6	42290585	critical splice acceptor site	probably null
R8818:Clcn1	UTSW	6	42305543	missense	probably damaging	0.98
R8945:Clcn1	UTSW	6	42286767	start codon destroyed	possibly damaging	0.79
Z1088:Clcn1	UTSW	6	42300360	missense	probably benign	0.40
Z1088:Clcn1	UTSW	6	42307256	missense	probably damaging	1.00
Z1176:Clcn1	UTSW	6	42307567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACCTCTCCAGGAAGATG -3'
(R):5'- TGGCCCATTAGGTTCTTCAGG -3'

Sequencing Primer
(F):5'- TCCAGGAAGATGGAGGTGACC -3'
(R):5'- CTTCAGGGTTTGATGGAGCAATAG -3'

Posted On

2020-05-18