Incidental Mutation 'R7847:Lrrfip2'
ID628622
Institutional Source Beutler Lab
Gene Symbol Lrrfip2
Ensembl Gene ENSMUSG00000032497
Gene Nameleucine rich repeat (in FLII) interacting protein 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location111117592-111225668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111213880 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 460 (L460P)
Ref Sequence ENSEMBL: ENSMUSP00000149845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000098340] [ENSMUST00000196981] [ENSMUST00000197241] [ENSMUST00000197256] [ENSMUST00000198986] [ENSMUST00000216430] [ENSMUST00000217117] [ENSMUST00000217341]
Predicted Effect probably benign
Transcript: ENSMUST00000035078
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098340
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196981
SMART Domains Protein: ENSMUSP00000142851
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 350 4.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197241
SMART Domains Protein: ENSMUSP00000142816
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 341 1.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197256
SMART Domains Protein: ENSMUSP00000143322
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 363 2.9e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198986
SMART Domains Protein: ENSMUSP00000143756
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 10 174 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216430
Predicted Effect probably benign
Transcript: ENSMUST00000217117
Predicted Effect probably damaging
Transcript: ENSMUST00000217341
AA Change: L460P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7241 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Lrrfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lrrfip2 APN 9 111219715 missense probably damaging 1.00
IGL01408:Lrrfip2 APN 9 111214216 missense probably benign 0.11
IGL01462:Lrrfip2 APN 9 111205849 critical splice donor site probably null
IGL01845:Lrrfip2 APN 9 111199660 splice site probably benign
IGL02218:Lrrfip2 APN 9 111219725 missense probably benign
IGL02986:Lrrfip2 APN 9 111161393 splice site probably null
R0091:Lrrfip2 UTSW 9 111214243 missense probably damaging 1.00
R1101:Lrrfip2 UTSW 9 111190225 missense probably damaging 1.00
R1722:Lrrfip2 UTSW 9 111199761 missense probably damaging 1.00
R2334:Lrrfip2 UTSW 9 111219725 missense probably benign
R2336:Lrrfip2 UTSW 9 111222215 missense probably damaging 1.00
R3103:Lrrfip2 UTSW 9 111222210 missense probably damaging 1.00
R4357:Lrrfip2 UTSW 9 111199687 missense probably damaging 1.00
R5010:Lrrfip2 UTSW 9 111223972 missense possibly damaging 0.79
R5072:Lrrfip2 UTSW 9 111199804 missense probably damaging 1.00
R6026:Lrrfip2 UTSW 9 111214171 missense probably damaging 1.00
R6307:Lrrfip2 UTSW 9 111223953 missense probably damaging 1.00
R6870:Lrrfip2 UTSW 9 111216119 intron probably benign
R7099:Lrrfip2 UTSW 9 111173108 missense probably benign 0.04
R7312:Lrrfip2 UTSW 9 111177457 intron probably null
R7429:Lrrfip2 UTSW 9 111185126 intron probably null
R7866:Lrrfip2 UTSW 9 111193081 missense possibly damaging 0.95
R7912:Lrrfip2 UTSW 9 111205768 missense probably damaging 1.00
Z1176:Lrrfip2 UTSW 9 111161340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACTCTCCCCAGCTGTGC -3'
(R):5'- ATGTTTGCCATGGGTAAAAGC -3'

Sequencing Primer
(F):5'- GTCCCCACTGCCTGGTCAC -3'
(R):5'- GTTTGCCATGGGTAAAAGCTAATG -3'
Posted On2020-05-27