Incidental Mutation 'R7789:Tssc4'
ID 628632
Institutional Source Beutler Lab
Gene Symbol Tssc4
Ensembl Gene ENSMUSG00000045752
Gene Name tumor-suppressing subchromosomal transferable fragment 4
Synonyms ESTM671070
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 143069249-143071093 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 143069778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000037941] [ENSMUST00000060433] [ENSMUST00000105920] [ENSMUST00000133410] [ENSMUST00000137856] [ENSMUST00000141954] [ENSMUST00000147995] [ENSMUST00000150867] [ENSMUST00000177841] [ENSMUST00000207448] [ENSMUST00000208779]
AlphaFold Q9JHE7
Predicted Effect probably benign
Transcript: ENSMUST00000009390
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037941
SMART Domains Protein: ENSMUSP00000043768
Gene: ENSMUSG00000037706

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 230 9.1e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060433
SMART Domains Protein: ENSMUSP00000056582
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 91 207 3.9e-43 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105920
SMART Domains Protein: ENSMUSP00000101540
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000133410
SMART Domains Protein: ENSMUSP00000123499
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:TSSC4 159 266 5.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136602
Predicted Effect probably null
Transcript: ENSMUST00000137856
SMART Domains Protein: ENSMUSP00000123353
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 209 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141954
Predicted Effect probably benign
Transcript: ENSMUST00000147995
SMART Domains Protein: ENSMUSP00000122335
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 196 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148715
Predicted Effect probably benign
Transcript: ENSMUST00000150867
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177841
SMART Domains Protein: ENSMUSP00000137399
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 210 1.7e-34 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207448
Predicted Effect probably benign
Transcript: ENSMUST00000208779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is located among several imprinted genes; however, this gene, as well as the pan-hematopoietic expression gene (PHEMX), escapes imprinting. This gene may play a role in malignancies and disease that involve this region. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Tssc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Tssc4 APN 7 143070201 missense probably benign 0.41
R0582:Tssc4 UTSW 7 143070509 missense probably damaging 0.97
R0655:Tssc4 UTSW 7 143070045 missense probably damaging 0.99
R1447:Tssc4 UTSW 7 143070155 missense probably benign 0.08
R1889:Tssc4 UTSW 7 143070555 missense probably damaging 1.00
R4677:Tssc4 UTSW 7 143070509 missense probably damaging 1.00
R4903:Tssc4 UTSW 7 143070585 missense probably damaging 0.99
R5144:Tssc4 UTSW 7 143070033 missense probably damaging 0.99
R7152:Tssc4 UTSW 7 143070402 missense probably damaging 1.00
R7198:Tssc4 UTSW 7 143070987 splice site probably null
R7417:Tssc4 UTSW 7 143070688 missense possibly damaging 0.91
R7468:Tssc4 UTSW 7 143069262 unclassified probably benign
R7510:Tssc4 UTSW 7 143069981 missense possibly damaging 0.91
R8178:Tssc4 UTSW 7 143070195 missense possibly damaging 0.79
R8808:Tssc4 UTSW 7 143069699 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGGCTGCGCTTTACTGAG -3'
(R):5'- GTAAGCTAAGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- CTTTACTGAGAGCCCGTGATG -3'
(R):5'- CATCCTCGGTGGGTTCATCAG -3'
Posted On 2020-06-01