Incidental Mutation 'R7814:Dsg1a'
ID 628638
Institutional Source Beutler Lab
Gene Symbol Dsg1a
Ensembl Gene ENSMUSG00000069441
Gene Name desmoglein 1 alpha
Synonyms Dsg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7814 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20310811-20343350 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 20338515 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077146]
AlphaFold Q61495
Predicted Effect probably null
Transcript: ENSMUST00000077146
SMART Domains Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 485 6.44e-1 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 590 598 N/A INTRINSIC
Pfam:Cadherin_C 659 781 1.6e-10 PFAM
low complexity region 786 799 N/A INTRINSIC
internal_repeat_1 823 888 9.56e-6 PROSPERO
internal_repeat_1 908 975 9.56e-6 PROSPERO
low complexity region 983 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Dsg1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Dsg1a APN 18 20340206 missense probably damaging 1.00
IGL01148:Dsg1a APN 18 20320925 missense probably damaging 0.97
IGL01534:Dsg1a APN 18 20340996 missense probably benign 0.06
IGL01566:Dsg1a APN 18 20336783 splice site probably benign
IGL01582:Dsg1a APN 18 20328848 missense probably null 1.00
IGL01913:Dsg1a APN 18 20322236 missense probably damaging 1.00
IGL01926:Dsg1a APN 18 20333584 missense possibly damaging 0.60
IGL02102:Dsg1a APN 18 20332032 missense probably benign 0.01
IGL02900:Dsg1a APN 18 20328656 splice site probably benign
IGL02937:Dsg1a APN 18 20331534 missense possibly damaging 0.93
IGL02962:Dsg1a APN 18 20340324 missense possibly damaging 0.92
IGL03003:Dsg1a APN 18 20336819 missense probably benign 0.43
PIT4687001:Dsg1a UTSW 18 20331698 missense probably benign 0.16
R0126:Dsg1a UTSW 18 20340878 missense probably benign 0.00
R0200:Dsg1a UTSW 18 20340938 missense probably benign 0.00
R0284:Dsg1a UTSW 18 20331627 missense probably damaging 0.98
R0394:Dsg1a UTSW 18 20333750 missense probably damaging 1.00
R0543:Dsg1a UTSW 18 20340863 missense probably damaging 1.00
R0656:Dsg1a UTSW 18 20335892 splice site probably benign
R0733:Dsg1a UTSW 18 20338668 missense probably damaging 0.97
R0750:Dsg1a UTSW 18 20340153 missense probably benign 0.10
R1300:Dsg1a UTSW 18 20332149 missense probably benign 0.19
R1501:Dsg1a UTSW 18 20332019 missense probably damaging 1.00
R1523:Dsg1a UTSW 18 20322317 missense probably damaging 0.99
R1673:Dsg1a UTSW 18 20331504 missense probably damaging 1.00
R1980:Dsg1a UTSW 18 20338650 missense probably damaging 1.00
R2102:Dsg1a UTSW 18 20333773 missense probably damaging 1.00
R2132:Dsg1a UTSW 18 20340797 missense probably damaging 1.00
R2299:Dsg1a UTSW 18 20340150 missense probably damaging 1.00
R2426:Dsg1a UTSW 18 20336804 missense probably damaging 0.96
R3031:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R4044:Dsg1a UTSW 18 20324030 missense probably damaging 1.00
R4075:Dsg1a UTSW 18 20340070 missense possibly damaging 0.53
R4644:Dsg1a UTSW 18 20340728 missense probably benign 0.04
R4661:Dsg1a UTSW 18 20340533 missense probably damaging 0.99
R4816:Dsg1a UTSW 18 20333722 missense probably benign 0.10
R5221:Dsg1a UTSW 18 20324014 missense possibly damaging 0.64
R5257:Dsg1a UTSW 18 20320931 missense probably damaging 1.00
R5360:Dsg1a UTSW 18 20340954 missense probably damaging 0.96
R5547:Dsg1a UTSW 18 20336040 critical splice donor site probably null
R5702:Dsg1a UTSW 18 20336865 critical splice donor site probably null
R5987:Dsg1a UTSW 18 20331542 missense probably damaging 1.00
R6108:Dsg1a UTSW 18 20340247 missense probably benign 0.19
R6170:Dsg1a UTSW 18 20335986 missense probably damaging 0.99
R7018:Dsg1a UTSW 18 20328738 missense possibly damaging 0.48
R7201:Dsg1a UTSW 18 20328311 missense probably damaging 0.98
R7730:Dsg1a UTSW 18 20331711 missense possibly damaging 0.77
R8185:Dsg1a UTSW 18 20340612 missense probably damaging 1.00
R8297:Dsg1a UTSW 18 20332033 missense probably benign 0.02
R8377:Dsg1a UTSW 18 20333774 missense probably damaging 1.00
R8409:Dsg1a UTSW 18 20340151 missense probably damaging 1.00
R8775:Dsg1a UTSW 18 20340507 missense probably damaging 0.98
R8775-TAIL:Dsg1a UTSW 18 20340507 missense probably damaging 0.98
R8818:Dsg1a UTSW 18 20340542 missense possibly damaging 0.87
R8821:Dsg1a UTSW 18 20320308 missense probably damaging 0.96
R8831:Dsg1a UTSW 18 20320308 missense probably damaging 0.96
R9030:Dsg1a UTSW 18 20340492 missense probably damaging 1.00
R9205:Dsg1a UTSW 18 20340171 missense probably damaging 1.00
R9239:Dsg1a UTSW 18 20340693 missense probably damaging 1.00
R9410:Dsg1a UTSW 18 20331533 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TACAGGAGCCCTTGTGCATC -3'
(R):5'- TGCAGCTGATGTTTTAACTCCATC -3'

Sequencing Primer
(F):5'- GGAGCCCTTGTGCATCCAAAAATAC -3'
(R):5'- CATCCATTAGTTCAAATCCTGTGG -3'
Posted On 2020-06-01