Mutagenetix > Incidental Mutation

Incidental Mutation 'R7835:Cachd1'

628640

Institutional Source

Beutler Lab

Gene Symbol

Cachd1

Ensembl Gene

ENSMUSG00000028532

Gene Name

cache domain containing 1

Synonyms

Vwcd1, B430218L07Rik, 1190007F10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R7835 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100776675-101029220 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to T at 100974153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]

AlphaFold

Q6PDJ1

Predicted Effect

probably null
Transcript: ENSMUST00000030257

SMART Domains

Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	9.4e-22	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	2.4e-12	PFAM
Pfam:Cache_1	786	871	1.5e-7	PFAM
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1240	1246	N/A	INTRINSIC
low complexity region	1260	1274	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000097955

SMART Domains

Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	6.7e-32	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	1.7e-12	PFAM
low complexity region	801	818	N/A	INTRINSIC
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,099,875	S1465T	probably benign	Het
Accsl	T	A	2: 93,865,984	K90*	probably null	Het
Adamts3	A	T	5: 89,700,440	D674E	possibly damaging	Het
Adap2	T	A	11: 80,160,231	V129D	probably benign	Het
Ank3	A	G	10: 69,987,727	D742G		Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C330021F23Rik	A	G	8: 3,580,452		probably benign	Het
Ccne1	G	T	7: 38,102,845	Q133K	probably benign	Het
Cers3	C	T	7: 66,773,639	H111Y	possibly damaging	Het
Chst5	A	T	8: 111,890,602	L129M	probably damaging	Het
Depdc7	A	G	2: 104,728,185	S164P	probably benign	Het
Dnah10	G	A	5: 124,777,234	A1966T	probably damaging	Het
Fam208a	G	T	14: 27,476,643	G1311C	probably damaging	Het
Fcgbp	T	G	7: 28,117,207	S2365A	possibly damaging	Het
Ihh	A	G	1: 74,946,366	V320A	probably damaging	Het
Kdm5d	T	C	Y: 900,558	V201A	possibly damaging	Het
Kif13b	T	A	14: 64,767,452	H1117Q	probably benign	Het
Lcn8	C	A	2: 25,655,296		probably null	Het
Lrp4	T	C	2: 91,495,042	V1404A	possibly damaging	Het
Lrrc61	A	T	6: 48,568,572	T110S	probably benign	Het
Mrpl19	G	A	6: 81,962,126	R232C	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Mzt1	T	C	14: 99,046,003	T21A	probably benign	Het
Naip6	G	T	13: 100,316,004	A183E	probably benign	Het
Neb	T	C	2: 52,150,577	D6624G	probably benign	Het
Nup85	A	G	11: 115,570,071	D183G	probably benign	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr828	T	A	9: 18,815,809	M162L	probably benign	Het
Piezo2	A	T	18: 63,082,945	F1216I	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Polr1a	T	C	6: 71,915,142	V135A	probably benign	Het
Ppcdc	A	G	9: 57,420,276	S83P	probably benign	Het
Prss21	A	T	17: 23,869,451	Q130L	possibly damaging	Het
Rdx	T	A	9: 52,065,788	N112K	probably damaging	Het
Rgs22	A	G	15: 36,081,911		probably null	Het
Rps26	C	T	10: 128,626,126	V40I	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc2	A	C	4: 130,275,487	C4G	unknown	Het
Sh3rf2	C	A	18: 42,111,170	R266S	probably benign	Het
Slc38a10	A	G	11: 120,116,996	I386T	possibly damaging	Het
Stab2	G	A	10: 86,872,619	P1694L	probably benign	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tmem102	A	G	11: 69,804,345	V267A	probably damaging	Het
Trim65	A	G	11: 116,130,929	L26P	probably damaging	Het
Vmn1r160	T	A	7: 22,871,954	M244K	possibly damaging	Het
Vmn1r57	A	T	7: 5,221,139	H221L	probably benign	Het
Wdr89	C	A	12: 75,632,899	V194F	probably damaging	Het
Wee1	C	A	7: 110,130,878	Y396*	probably null	Het
Zfp451	A	T	1: 33,772,979	V885D	probably damaging	Het
Zfp981	A	T	4: 146,537,876	Q419H	probably benign	Het
Znfx1	A	G	2: 167,039,827	Y1081H	probably damaging	Het

Other mutations in Cachd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Cachd1	APN	4	100966966	missense	probably benign	0.05
IGL01531:Cachd1	APN	4	100953034	missense	probably benign	0.02
IGL01705:Cachd1	APN	4	100983539	missense	possibly damaging	0.46
IGL01843:Cachd1	APN	4	100992872	missense	probably damaging	0.98
IGL01938:Cachd1	APN	4	100974128	missense	possibly damaging	0.59
IGL02268:Cachd1	APN	4	100952097	missense	possibly damaging	0.75
IGL02934:Cachd1	APN	4	100968098	missense	probably damaging	0.98
IGL03019:Cachd1	APN	4	100952085	missense	probably damaging	0.98
IGL03084:Cachd1	APN	4	101003088	missense	probably damaging	0.99
R0366:Cachd1	UTSW	4	100994737	missense	possibly damaging	0.94
R0395:Cachd1	UTSW	4	100953205	missense	probably damaging	1.00
R0520:Cachd1	UTSW	4	100897703	missense	probably damaging	0.99
R0578:Cachd1	UTSW	4	100994842	splice site	probably benign
R0646:Cachd1	UTSW	4	100988221	missense	probably damaging	1.00
R0689:Cachd1	UTSW	4	100974876	missense	probably damaging	1.00
R0962:Cachd1	UTSW	4	100983301	splice site	probably benign
R1156:Cachd1	UTSW	4	100988619	missense	probably damaging	1.00
R1157:Cachd1	UTSW	4	100974840	missense	possibly damaging	0.77
R1314:Cachd1	UTSW	4	100974917	missense	probably damaging	1.00
R1482:Cachd1	UTSW	4	100988598	missense	possibly damaging	0.94
R1632:Cachd1	UTSW	4	100966972	missense	probably benign	0.02
R1774:Cachd1	UTSW	4	100964435	missense	probably damaging	1.00
R1774:Cachd1	UTSW	4	100967043	missense	probably benign	0.02
R1845:Cachd1	UTSW	4	100777358	missense	probably benign	0.01
R1869:Cachd1	UTSW	4	100983390	missense	probably damaging	1.00
R1912:Cachd1	UTSW	4	100953169	missense	probably damaging	0.99
R2069:Cachd1	UTSW	4	100990844	missense	probably damaging	1.00
R2082:Cachd1	UTSW	4	101002958	missense	probably damaging	1.00
R2267:Cachd1	UTSW	4	100949069	splice site	probably benign
R2517:Cachd1	UTSW	4	100980882	splice site	probably null
R2896:Cachd1	UTSW	4	100970903	missense	probably damaging	1.00
R3729:Cachd1	UTSW	4	100974880	nonsense	probably null
R3818:Cachd1	UTSW	4	100990865	missense	probably damaging	1.00
R3979:Cachd1	UTSW	4	100970888	missense	probably damaging	1.00
R4647:Cachd1	UTSW	4	100953130	nonsense	probably null
R4791:Cachd1	UTSW	4	100918085	missense	probably damaging	1.00
R5133:Cachd1	UTSW	4	100994738	missense	probably damaging	0.98
R5147:Cachd1	UTSW	4	100964491	missense	probably damaging	1.00
R5187:Cachd1	UTSW	4	100966200	missense	possibly damaging	0.94
R5322:Cachd1	UTSW	4	100952122	missense	probably damaging	0.98
R5335:Cachd1	UTSW	4	100968085	missense	possibly damaging	0.88
R5390:Cachd1	UTSW	4	100981006	missense	probably damaging	1.00
R5573:Cachd1	UTSW	4	100974079	missense	probably damaging	0.99
R5578:Cachd1	UTSW	4	100865006	missense	probably benign	0.31
R5905:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6003:Cachd1	UTSW	4	100952019	missense	possibly damaging	0.79
R6028:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6185:Cachd1	UTSW	4	100981031	nonsense	probably null
R6367:Cachd1	UTSW	4	101002970	missense	probably damaging	1.00
R6492:Cachd1	UTSW	4	100952118	missense	possibly damaging	0.89
R6591:Cachd1	UTSW	4	100989486	missense	probably benign
R6691:Cachd1	UTSW	4	100989486	missense	probably benign
R7129:Cachd1	UTSW	4	100918066	missense	probably null	0.99
R7187:Cachd1	UTSW	4	100976355	missense	possibly damaging	0.95
R7387:Cachd1	UTSW	4	100777178	missense	unknown
R7833:Cachd1	UTSW	4	100974815	missense	probably benign	0.09
R7838:Cachd1	UTSW	4	100967014	missense	possibly damaging	0.71
R7867:Cachd1	UTSW	4	100988562	missense	probably damaging	0.97
R7882:Cachd1	UTSW	4	100967047	missense	probably benign	0.29
R7941:Cachd1	UTSW	4	100988173	missense	probably damaging	1.00
R7978:Cachd1	UTSW	4	100974863	missense	probably damaging	1.00
R8085:Cachd1	UTSW	4	100988164	missense	probably damaging	1.00
R8153:Cachd1	UTSW	4	100988638	critical splice donor site	probably null
R8174:Cachd1	UTSW	4	100966269	missense	probably damaging	0.99
R8219:Cachd1	UTSW	4	100990962	missense	probably benign	0.34
R8358:Cachd1	UTSW	4	100959471	missense	possibly damaging	0.94
R8376:Cachd1	UTSW	4	100974876	missense	probably damaging	0.99
R8686:Cachd1	UTSW	4	100988128	missense	probably damaging	0.99
R8747:Cachd1	UTSW	4	101002848	intron	probably benign
R8845:Cachd1	UTSW	4	100953146	missense	probably benign	0.36
R8864:Cachd1	UTSW	4	100994829	missense	probably damaging	0.99
R8869:Cachd1	UTSW	4	100952083	missense	probably benign	0.09
R8870:Cachd1	UTSW	4	100897781	missense	probably damaging	0.99
R8904:Cachd1	UTSW	4	100953166	missense	probably damaging	1.00
R8958:Cachd1	UTSW	4	100994086	missense	probably benign	0.11
R9061:Cachd1	UTSW	4	100952005	critical splice acceptor site	probably null
R9193:Cachd1	UTSW	4	100777142	missense	unknown
R9304:Cachd1	UTSW	4	100966982	missense	possibly damaging	0.81
R9358:Cachd1	UTSW	4	100976425	missense	probably damaging	0.99
R9373:Cachd1	UTSW	4	100974870	missense	possibly damaging	0.94
R9425:Cachd1	UTSW	4	100974860	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCCTCTGTGTTCTGAGAC -3'
(R):5'- AAGTAGACTCTTCCCGTGGC -3'

Sequencing Primer
(F):5'- CTCTGTGTTCTGAGACCTGCTTTG -3'
(R):5'- GGGCTTCTTAATCCATCAAAAAGGTC -3'

Posted On

2020-06-01