Incidental Mutation 'R7777:Tmprss7'
ID 628647
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Name transmembrane serine protease 7
Synonyms B230219I23Rik, LOC385645, matriptase-3
MMRRC Submission 045833-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7777 (G1)
Quality Score 189.009
Status Validated
Chromosome 16
Chromosomal Location 45476678-45514021 bp(-) (GRCm39)
Type of Mutation splice site (40 bp from exon)
DNA Base Change (assembly) A to G at 45480963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114562]
AlphaFold Q8BIK6
Predicted Effect probably null
Transcript: ENSMUST00000114562
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,758 (GRCm39) P192S possibly damaging Het
Arhgef10 A G 8: 14,995,373 (GRCm39) T353A probably damaging Het
Cabyr A G 18: 12,877,828 (GRCm39) D55G probably damaging Het
Dcaf4 T C 12: 83,584,733 (GRCm39) V322A probably damaging Het
Ephb2 T A 4: 136,498,947 (GRCm39) E44V possibly damaging Het
Fam3c T C 6: 22,328,573 (GRCm39) I105V probably benign Het
Fras1 A G 5: 96,900,763 (GRCm39) D2994G probably damaging Het
Fryl C T 5: 73,228,641 (GRCm39) D1697N probably damaging Het
Gapdh A T 6: 125,139,911 (GRCm39) Y164* probably null Het
Gm4353 T G 7: 115,682,998 (GRCm39) Q194H possibly damaging Het
Ilvbl T A 10: 78,413,085 (GRCm39) probably null Het
Ism2 T A 12: 87,333,658 (GRCm39) probably null Het
Jak2 C T 19: 29,254,268 (GRCm39) T196I probably benign Het
Lcor T G 19: 41,547,234 (GRCm39) Y273D probably benign Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lysmd4 T A 7: 66,873,446 (GRCm39) M27K possibly damaging Het
Muc17 G A 5: 137,175,564 (GRCm39) silent Het
Or11h4b A T 14: 50,918,261 (GRCm39) Y277N probably damaging Het
Or13a25 T A 7: 140,247,854 (GRCm39) I211N probably benign Het
Or5m10 A G 2: 85,717,951 (GRCm39) E269G possibly damaging Het
Oscp1 T C 4: 125,958,774 (GRCm39) probably null Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Pkd2l2 C A 18: 34,549,913 (GRCm39) P186Q probably damaging Het
Plcb1 G A 2: 135,062,677 (GRCm39) G96R possibly damaging Het
Plcd3 G C 11: 102,965,481 (GRCm39) R535G probably benign Het
Plcg1 A G 2: 160,596,523 (GRCm39) M681V possibly damaging Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Polrmt A T 10: 79,575,022 (GRCm39) D836E probably benign Het
Pramel12 T C 4: 143,144,331 (GRCm39) Y226H possibly damaging Het
Prkag1 A T 15: 98,712,478 (GRCm39) I149N probably damaging Het
Prkci A T 3: 31,104,362 (GRCm39) Q575L possibly damaging Het
Prss40 C T 1: 34,591,846 (GRCm39) W276* probably null Het
Ptprn T C 1: 75,228,946 (GRCm39) D823G possibly damaging Het
Radil A C 5: 142,529,303 (GRCm39) F131C probably damaging Het
Rif1 A G 2: 52,006,368 (GRCm39) I550V probably benign Het
Rmnd1 T C 10: 4,361,713 (GRCm39) E320G probably damaging Het
Sec31b T A 19: 44,512,212 (GRCm39) K561* probably null Het
Spata31g1 C T 4: 42,970,171 (GRCm39) Q53* probably null Het
Spata31g1 T C 4: 42,971,095 (GRCm39) S143P probably benign Het
Tbx5 A C 5: 120,021,232 (GRCm39) T413P probably benign Het
Tnfaip8l2 T C 3: 95,047,307 (GRCm39) *185W probably null Het
Tpst2 A G 5: 112,457,560 (GRCm39) E296G possibly damaging Het
Ubn2 T A 6: 38,467,688 (GRCm39) S801T probably damaging Het
Usp34 A G 11: 23,332,638 (GRCm39) S1141G Het
Uts2r A G 11: 121,052,279 (GRCm39) N381S probably benign Het
Vmn2r44 G T 7: 8,381,314 (GRCm39) T193K possibly damaging Het
Wdr18 T A 10: 79,801,884 (GRCm39) M223K probably benign Het
Wdr64 T C 1: 175,617,564 (GRCm39) C715R possibly damaging Het
Zfp672 A G 11: 58,208,081 (GRCm39) F80S possibly damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45,483,731 (GRCm39) missense probably benign
IGL00985:Tmprss7 APN 16 45,482,685 (GRCm39) missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45,481,152 (GRCm39) missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45,504,937 (GRCm39) missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45,484,538 (GRCm39) missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45,483,706 (GRCm39) missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45,500,997 (GRCm39) missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45,501,956 (GRCm39) missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45,489,891 (GRCm39) missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45,476,818 (GRCm39) missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45,501,111 (GRCm39) missense probably benign
amalgum UTSW 16 45,503,873 (GRCm39) missense probably benign 0.15
fusion UTSW 16 45,511,123 (GRCm39) missense probably damaging 1.00
steely UTSW 16 45,487,969 (GRCm39) nonsense probably null
P0019:Tmprss7 UTSW 16 45,501,096 (GRCm39) missense probably benign
R0051:Tmprss7 UTSW 16 45,494,302 (GRCm39) missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45,494,302 (GRCm39) missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45,487,959 (GRCm39) missense probably damaging 1.00
R0178:Tmprss7 UTSW 16 45,511,206 (GRCm39) missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45,476,820 (GRCm39) missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45,501,001 (GRCm39) missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45,489,914 (GRCm39) missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45,498,325 (GRCm39) nonsense probably null
R0783:Tmprss7 UTSW 16 45,487,969 (GRCm39) nonsense probably null
R1447:Tmprss7 UTSW 16 45,501,033 (GRCm39) missense probably benign
R1538:Tmprss7 UTSW 16 45,499,753 (GRCm39) missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45,482,516 (GRCm39) critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45,476,911 (GRCm39) nonsense probably null
R1932:Tmprss7 UTSW 16 45,504,956 (GRCm39) nonsense probably null
R2257:Tmprss7 UTSW 16 45,506,696 (GRCm39) missense possibly damaging 0.47
R3840:Tmprss7 UTSW 16 45,481,195 (GRCm39) nonsense probably null
R4232:Tmprss7 UTSW 16 45,476,936 (GRCm39) missense probably damaging 1.00
R4332:Tmprss7 UTSW 16 45,506,690 (GRCm39) missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45,499,711 (GRCm39) missense probably benign
R4712:Tmprss7 UTSW 16 45,511,123 (GRCm39) missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45,483,679 (GRCm39) missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45,481,252 (GRCm39) missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45,489,891 (GRCm39) missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45,476,811 (GRCm39) missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45,481,267 (GRCm39) missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45,506,793 (GRCm39) missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45,494,268 (GRCm39) nonsense probably null
R6235:Tmprss7 UTSW 16 45,478,485 (GRCm39) missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45,489,936 (GRCm39) missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45,511,326 (GRCm39) missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45,498,317 (GRCm39) missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45,511,256 (GRCm39) missense probably benign
R7634:Tmprss7 UTSW 16 45,483,637 (GRCm39) missense probably benign 0.00
R7747:Tmprss7 UTSW 16 45,503,873 (GRCm39) missense probably benign 0.15
R7776:Tmprss7 UTSW 16 45,488,014 (GRCm39) missense probably benign 0.03
R8222:Tmprss7 UTSW 16 45,478,461 (GRCm39) missense probably damaging 0.99
R8983:Tmprss7 UTSW 16 45,481,263 (GRCm39) missense probably damaging 0.98
R9472:Tmprss7 UTSW 16 45,501,052 (GRCm39) missense probably benign 0.09
R9485:Tmprss7 UTSW 16 45,498,282 (GRCm39) nonsense probably null
R9502:Tmprss7 UTSW 16 45,484,555 (GRCm39) missense probably damaging 1.00
R9516:Tmprss7 UTSW 16 45,484,564 (GRCm39) missense probably benign 0.00
T0975:Tmprss7 UTSW 16 45,501,096 (GRCm39) missense probably benign
Z1176:Tmprss7 UTSW 16 45,482,619 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTGTAGGGCAGAGACATGAG -3'
(R):5'- ATGACATTGCCTTGCTGCAG -3'

Sequencing Primer
(F):5'- CCACTAGCAGCTTTTGGATGAAGAC -3'
(R):5'- TGCAGCTCAGCATAGCCTG -3'
Posted On 2020-06-01