Incidental Mutation 'R7900:Tpd52l1'
ID628663
Institutional Source Beutler Lab
Gene Symbol Tpd52l1
Ensembl Gene ENSMUSG00000000296
Gene Nametumor protein D52-like 1
SynonymsD53
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7900 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location31332376-31445958 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 31338182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000305] [ENSMUST00000213528] [ENSMUST00000213639] [ENSMUST00000214644] [ENSMUST00000215515]
Predicted Effect probably null
Transcript: ENSMUST00000000305
SMART Domains Protein: ENSMUSP00000000305
Gene: ENSMUSG00000000296

DomainStartEndE-ValueType
Pfam:TPD52 9 187 1.3e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213528
Predicted Effect probably null
Transcript: ENSMUST00000213639
Predicted Effect probably benign
Transcript: ENSMUST00000214644
Predicted Effect probably benign
Transcript: ENSMUST00000215515
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain coiled-coil domains and may form hetero- or homomers. The encoded protein is involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamtsl5 A G 10: 80,341,901 F309S probably damaging Het
Ankle1 C T 8: 71,407,417 T213I probably damaging Het
C4b A G 17: 34,739,777 S528P probably benign Het
Camk2a A G 18: 60,957,366 Y222C probably damaging Het
Cnst A G 1: 179,622,888 D639G probably damaging Het
Ctbp2 A C 7: 133,014,599 S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 L798F probably damaging Het
Cyp11a1 T A 9: 58,016,384 V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 probably null Het
Dlst G T 12: 85,130,518 R346L probably benign Het
Dnah2 A G 11: 69,518,428 S375P probably damaging Het
Dnm3 T A 1: 162,355,371 Y125F probably benign Het
Dock9 C T 14: 121,546,079 A2011T possibly damaging Het
Efr3a T A 15: 65,848,135 probably null Het
Egln1 A T 8: 124,914,140 I319N possibly damaging Het
Gata3 T A 2: 9,858,650 N351I probably damaging Het
Gjc1 T C 11: 102,800,094 N361S probably benign Het
Gpcpd1 T C 2: 132,534,739 T546A probably damaging Het
Gpihbp1 T C 15: 75,597,942 F169L probably benign Het
Gpnmb A T 6: 49,050,466 I375L possibly damaging Het
Itpka A T 2: 119,750,513 T381S probably benign Het
Lhx4 T C 1: 155,741,963 probably benign Het
Lrguk T C 6: 34,129,194 L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nr1d1 T A 11: 98,769,711 T477S probably benign Het
Nxnl1 A T 8: 71,566,526 D18E probably damaging Het
Olfr1434 T A 19: 12,283,341 C98S probably damaging Het
Olfr620 T C 7: 103,611,693 Y220C possibly damaging Het
Onecut2 G T 18: 64,341,587 R403L probably damaging Het
Pla2r1 T C 2: 60,428,514 T1177A possibly damaging Het
Prkd2 T C 7: 16,853,344 V405A probably benign Het
Ranbp1 T C 16: 18,245,297 T72A probably damaging Het
Retnla A C 16: 48,843,614 R90S probably benign Het
Sec31b A T 19: 44,526,230 I385N probably damaging Het
Slc6a19 C T 13: 73,700,464 R57H probably damaging Het
Smurf1 T C 5: 144,899,373 D110G probably damaging Het
Specc1 A G 11: 62,219,361 Y975C probably damaging Het
Tas2r136 T A 6: 132,777,636 N176I possibly damaging Het
Tecrl A C 5: 83,279,341 V320G probably benign Het
Tmem245 A G 4: 56,924,973 probably null Het
Trbv2 A G 6: 41,047,974 Y108C probably damaging Het
Trpm7 T C 2: 126,797,498 M1689V probably benign Het
Usp24 A G 4: 106,409,400 Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 S721R possibly damaging Het
Vwf G A 6: 125,628,476 probably null Het
Washc4 T A 10: 83,573,773 probably null Het
Yeats4 G A 10: 117,220,559 H71Y possibly damaging Het
Zbtb38 A C 9: 96,688,936 L32V probably damaging Het
Zfy1 T C Y: 725,519 T749A possibly damaging Het
Other mutations in Tpd52l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0134:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0225:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R4411:Tpd52l1 UTSW 10 31379319 missense possibly damaging 0.88
R4828:Tpd52l1 UTSW 10 31346701 missense probably damaging 1.00
R5073:Tpd52l1 UTSW 10 31357920 missense probably damaging 1.00
R5925:Tpd52l1 UTSW 10 31332947 missense probably benign 0.18
R6332:Tpd52l1 UTSW 10 31338207 missense probably damaging 1.00
R6848:Tpd52l1 UTSW 10 31332857 missense probably benign 0.03
R6906:Tpd52l1 UTSW 10 31332954 missense possibly damaging 0.47
R7935:Tpd52l1 UTSW 10 31338205 missense probably damaging 0.99
R8010:Tpd52l1 UTSW 10 31358013 missense possibly damaging 0.89
R8011:Tpd52l1 UTSW 10 31332917 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTCTAAGGATGCAGGAAGACTC -3'
(R):5'- AGTTGGTCCAGGTCACAAGC -3'

Sequencing Primer
(F):5'- CTCGTGGCTGCTGACTTTATCAATAG -3'
(R):5'- TCCAGGTCACAAGCCGAGAG -3'
Posted On2020-06-01