Incidental Mutation 'R7900:Washc4'
ID628664
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7900 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 83573773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably null
Transcript: ENSMUST00000038388
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038388
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamtsl5 A G 10: 80,341,901 F309S probably damaging Het
Ankle1 C T 8: 71,407,417 T213I probably damaging Het
C4b A G 17: 34,739,777 S528P probably benign Het
Camk2a A G 18: 60,957,366 Y222C probably damaging Het
Cnst A G 1: 179,622,888 D639G probably damaging Het
Ctbp2 A C 7: 133,014,599 S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 L798F probably damaging Het
Cyp11a1 T A 9: 58,016,384 V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 probably null Het
Dlst G T 12: 85,130,518 R346L probably benign Het
Dnah2 A G 11: 69,518,428 S375P probably damaging Het
Dnm3 T A 1: 162,355,371 Y125F probably benign Het
Dock9 C T 14: 121,546,079 A2011T possibly damaging Het
Efr3a T A 15: 65,848,135 probably null Het
Egln1 A T 8: 124,914,140 I319N possibly damaging Het
Gata3 T A 2: 9,858,650 N351I probably damaging Het
Gjc1 T C 11: 102,800,094 N361S probably benign Het
Gpcpd1 T C 2: 132,534,739 T546A probably damaging Het
Gpihbp1 T C 15: 75,597,942 F169L probably benign Het
Gpnmb A T 6: 49,050,466 I375L possibly damaging Het
Itpka A T 2: 119,750,513 T381S probably benign Het
Lhx4 T C 1: 155,741,963 probably benign Het
Lrguk T C 6: 34,129,194 L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nr1d1 T A 11: 98,769,711 T477S probably benign Het
Nxnl1 A T 8: 71,566,526 D18E probably damaging Het
Olfr1434 T A 19: 12,283,341 C98S probably damaging Het
Olfr620 T C 7: 103,611,693 Y220C possibly damaging Het
Onecut2 G T 18: 64,341,587 R403L probably damaging Het
Pla2r1 T C 2: 60,428,514 T1177A possibly damaging Het
Prkd2 T C 7: 16,853,344 V405A probably benign Het
Ranbp1 T C 16: 18,245,297 T72A probably damaging Het
Retnla A C 16: 48,843,614 R90S probably benign Het
Sec31b A T 19: 44,526,230 I385N probably damaging Het
Slc6a19 C T 13: 73,700,464 R57H probably damaging Het
Smurf1 T C 5: 144,899,373 D110G probably damaging Het
Specc1 A G 11: 62,219,361 Y975C probably damaging Het
Tas2r136 T A 6: 132,777,636 N176I possibly damaging Het
Tecrl A C 5: 83,279,341 V320G probably benign Het
Tmem245 A G 4: 56,924,973 probably null Het
Tpd52l1 T A 10: 31,338,182 probably null Het
Trbv2 A G 6: 41,047,974 Y108C probably damaging Het
Trpm7 T C 2: 126,797,498 M1689V probably benign Het
Usp24 A G 4: 106,409,400 Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 S721R possibly damaging Het
Vwf G A 6: 125,628,476 probably null Het
Yeats4 G A 10: 117,220,559 H71Y possibly damaging Het
Zbtb38 A C 9: 96,688,936 L32V probably damaging Het
Zfy1 T C Y: 725,519 T749A possibly damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R8491:Washc4 UTSW 10 83576123 missense probably benign 0.24
R8791:Washc4 UTSW 10 83550884 missense probably benign 0.08
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AATTTTCACTGTGGAGACATGC -3'
(R):5'- ATCATTGCAGGTCAGTTGTAGG -3'

Sequencing Primer
(F):5'- GTGGAGACATGCACATAATTATGC -3'
(R):5'- GGGTGGGTTATTAAATCAAATGACC -3'
Posted On2020-06-01