Incidental Mutation 'R7871:Cse1l'
ID 628669
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 045923-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7871 (G1)
Quality Score 124.008
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 166777591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163437
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,331,092 (GRCm39) S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,361,864 (GRCm39) probably null Het
Arpin A T 7: 79,577,463 (GRCm39) W195R probably damaging Het
Asap1 A G 15: 63,963,925 (GRCm39) V1091A probably damaging Het
Asxl3 A G 18: 22,657,281 (GRCm39) T1764A not run Het
Bmp7 C A 2: 172,781,784 (GRCm39) A27S probably benign Het
Ccnh T A 13: 85,359,991 (GRCm39) Y297* probably null Het
Ccno C A 13: 113,124,647 (GRCm39) D72E probably benign Het
Cd70 T G 17: 57,455,770 (GRCm39) T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,514,966 (GRCm39) probably null Het
Chst4 A G 8: 110,757,545 (GRCm39) F106S probably damaging Het
Cntnap3 A C 13: 65,051,587 (GRCm39) L23R probably benign Het
Crybg2 T A 4: 133,814,910 (GRCm39) L1288H probably damaging Het
Cyfip2 T C 11: 46,133,177 (GRCm39) H841R probably damaging Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp4f18 G A 8: 72,742,487 (GRCm39) P498S possibly damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dnah3 T A 7: 119,566,775 (GRCm39) I97F Het
Entpd3 A G 9: 120,389,652 (GRCm39) R313G possibly damaging Het
Erg28 G A 12: 85,866,253 (GRCm39) T75I probably damaging Het
Fam171a1 A G 2: 3,226,421 (GRCm39) H518R probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Galntl6 T C 8: 58,290,222 (GRCm39) E457G probably damaging Het
Glt8d1 A T 14: 30,732,296 (GRCm39) H192L probably damaging Het
Gm15446 T A 5: 110,091,165 (GRCm39) C472* probably null Het
Gm28363 A T 1: 117,625,228 (GRCm39) M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gstp3 T A 19: 4,108,746 (GRCm39) K45* probably null Het
Hsd17b13 A G 5: 104,113,681 (GRCm39) F258L possibly damaging Het
Htt T C 5: 35,021,993 (GRCm39) S1646P probably benign Het
Ipo11 T C 13: 107,028,976 (GRCm39) M326V probably benign Het
Itpr3 T A 17: 27,336,153 (GRCm39) I2293N probably damaging Het
Klk1b8 A G 7: 43,448,750 (GRCm39) probably null Het
Kntc1 T A 5: 123,922,290 (GRCm39) L963H probably damaging Het
Lyst T A 13: 13,810,637 (GRCm39) L769* probably null Het
Map3k13 A G 16: 21,740,346 (GRCm39) S558G probably benign Het
Mbd1 G A 18: 74,407,128 (GRCm39) probably null Het
Mep1a T C 17: 43,790,126 (GRCm39) N408D probably benign Het
Mtrf1 A G 14: 79,644,378 (GRCm39) T229A probably benign Het
Muc4 C T 16: 32,754,935 (GRCm38) S1603L unknown Het
Myo1b A C 1: 51,818,739 (GRCm39) I512S possibly damaging Het
N4bp2 A G 5: 65,964,446 (GRCm39) I832V probably benign Het
Nadsyn1 T A 7: 143,352,233 (GRCm39) K618* probably null Het
Ncstn T C 1: 171,903,023 (GRCm39) D87G probably benign Het
Neurl4 T C 11: 69,794,012 (GRCm39) V156A probably benign Het
Nfasc C A 1: 132,527,751 (GRCm39) G885V not run Het
Nox4 A T 7: 86,963,335 (GRCm39) Y180F possibly damaging Het
Nuggc A G 14: 65,860,700 (GRCm39) T449A probably benign Het
Or6c209 A G 10: 129,483,281 (GRCm39) I95V probably benign Het
Pik3r4 T C 9: 105,540,316 (GRCm39) S735P probably damaging Het
Ppp1r9b T C 11: 94,892,735 (GRCm39) I645T probably damaging Het
Rras2 G A 7: 113,716,783 (GRCm39) probably benign Het
Rtel1 T C 2: 180,962,822 (GRCm39) M25T probably damaging Het
Serpinb3c T A 1: 107,200,883 (GRCm39) Y178F possibly damaging Het
Sh3bp2 A G 5: 34,716,429 (GRCm39) H280R not run Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Skor1 T C 9: 63,053,783 (GRCm39) E62G probably damaging Het
Slc22a22 T A 15: 57,126,751 (GRCm39) N106I possibly damaging Het
Slc44a4 T A 17: 35,142,828 (GRCm39) probably null Het
Sppl2c A G 11: 104,079,342 (GRCm39) probably null Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stx5a T A 19: 8,732,482 (GRCm39) W384R unknown Het
Topaz1 A G 9: 122,609,765 (GRCm39) Y1111C possibly damaging Het
Ttbk1 T A 17: 46,757,164 (GRCm39) M1157L probably benign Het
Ttn T C 2: 76,578,489 (GRCm39) T24135A probably damaging Het
Ttn T C 2: 76,795,481 (GRCm39) E632G unknown Het
Ttn T C 2: 76,547,559 (GRCm39) T32204A probably benign Het
Vmn2r109 T C 17: 20,760,782 (GRCm39) I858M probably benign Het
Vmn2r71 A T 7: 85,272,869 (GRCm39) Q561L possibly damaging Het
Yme1l1 A G 2: 23,071,077 (GRCm39) D271G probably damaging Het
Zfp629 A G 7: 127,211,167 (GRCm39) F214S probably damaging Het
Zfp709 A G 8: 72,643,308 (GRCm39) I246V probably benign Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTCTTGGGCTCTGATC -3'
(R):5'- ACGAACTCTCAGCCTTTCACTG -3'

Sequencing Primer
(F):5'- GGGCTCTGATCTTCACCCAG -3'
(R):5'- AACTCTCAGCCTTTCACTGTGGAG -3'
Posted On 2020-06-08