Incidental Mutation 'R7871:Klk8'
ID628670
Institutional Source Beutler Lab
Gene Symbol Klk8
Ensembl Gene ENSMUSG00000064023
Gene Namekallikrein related-peptidase 8
SynonymsBSP1, Nrpn, Prss19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7871 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43797577-43803826 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 43799326 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005891] [ENSMUST00000085461] [ENSMUST00000205537]
Predicted Effect probably benign
Transcript: ENSMUST00000005891
SMART Domains Protein: ENSMUSP00000005891
Gene: ENSMUSG00000047884

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 22 244 1.66e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085461
SMART Domains Protein: ENSMUSP00000082588
Gene: ENSMUSG00000064023

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 32 252 8.87e-99 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205537
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein exhibit impaired long-term potentiation and increased anxiety, as well as a hyperkeratosis phenotype. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show aberrant synapses and neurons in the hippocampus CA1 field. Homozygotes for another null allele have normal LTP and spatial reference memory but show increased polyspiking in response to repetitive afferent stimulation and enhanced kainite-induced seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,183,226 S1041P probably benign Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,038 probably null Het
Arpin A T 7: 79,927,715 W195R probably damaging Het
Asap1 A G 15: 64,092,076 V1091A probably damaging Het
Asxl3 A G 18: 22,524,224 T1764A not run Het
Bmp7 C A 2: 172,939,991 A27S probably benign Het
Ccnh T A 13: 85,211,872 Y297* probably null Het
Ccno C A 13: 112,988,113 D72E probably benign Het
Cd70 T G 17: 57,148,770 T67P probably damaging Het
Chml CTGTTTG CTG 1: 175,687,400 probably null Het
Chst4 A G 8: 110,030,913 F106S probably damaging Het
Cntnap3 A C 13: 64,903,773 L23R probably benign Het
Crybg2 T A 4: 134,087,599 L1288H probably damaging Het
Cse1l T A 2: 166,935,671 probably null Het
Cyfip2 T C 11: 46,242,350 H841R probably damaging Het
Cyp2c39 T C 19: 39,560,961 Y308H possibly damaging Het
Cyp4f18 G A 8: 71,988,643 P498S possibly damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dnah3 T A 7: 119,967,552 I97F Het
Entpd3 A G 9: 120,560,586 R313G possibly damaging Het
Erg28 G A 12: 85,819,479 T75I probably damaging Het
Fam171a1 A G 2: 3,225,384 H518R probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Galntl6 T C 8: 57,837,188 E457G probably damaging Het
Glt8d1 A T 14: 31,010,339 H192L probably damaging Het
Gm15446 T A 5: 109,943,299 C472* probably null Het
Gm28363 A T 1: 117,697,498 M1L unknown Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gstp3 T A 19: 4,058,746 K45* probably null Het
Hsd17b13 A G 5: 103,965,815 F258L possibly damaging Het
Htt T C 5: 34,864,649 S1646P probably benign Het
Ipo11 T C 13: 106,892,468 M326V probably benign Het
Itpr3 T A 17: 27,117,179 I2293N probably damaging Het
Kntc1 T A 5: 123,784,227 L963H probably damaging Het
Lyst T A 13: 13,636,052 L769* probably null Het
Map3k13 A G 16: 21,921,596 S558G probably benign Het
Mbd1 G A 18: 74,274,057 probably null Het
Mep1a T C 17: 43,479,235 N408D probably benign Het
Mtrf1 A G 14: 79,406,938 T229A probably benign Het
Muc4 C T 16: 32,754,935 S1603L unknown Het
Myo1b A C 1: 51,779,580 I512S possibly damaging Het
N4bp2 A G 5: 65,807,103 I832V probably benign Het
Nadsyn1 T A 7: 143,798,496 K618* probably null Het
Ncstn T C 1: 172,075,456 D87G probably benign Het
Neurl4 T C 11: 69,903,186 V156A probably benign Het
Nfasc C A 1: 132,600,013 G885V not run Het
Nox4 A T 7: 87,314,127 Y180F possibly damaging Het
Nuggc A G 14: 65,623,251 T449A probably benign Het
Olfr799 A G 10: 129,647,412 I95V probably benign Het
Pik3r4 T C 9: 105,663,117 S735P probably damaging Het
Ppp1r9b T C 11: 95,001,909 I645T probably damaging Het
Rras2 G A 7: 114,117,548 probably benign Het
Rtel1 T C 2: 181,321,029 M25T probably damaging Het
Serpinb3c T A 1: 107,273,153 Y178F possibly damaging Het
Sh3bp2 A G 5: 34,559,085 H280R not run Het
Six4 CT C 12: 73,104,239 probably benign Het
Skor1 T C 9: 63,146,501 E62G probably damaging Het
Slc22a22 T A 15: 57,263,355 N106I possibly damaging Het
Slc44a4 T A 17: 34,923,852 probably null Het
Sppl2c A G 11: 104,188,516 probably null Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stx5a T A 19: 8,755,118 W384R unknown Het
Topaz1 A G 9: 122,780,700 Y1111C possibly damaging Het
Ttbk1 T A 17: 46,446,238 M1157L probably benign Het
Ttn T C 2: 76,717,215 T32204A probably benign Het
Ttn T C 2: 76,965,137 E632G unknown Het
Ttn T C 2: 76,748,145 T24135A probably damaging Het
Vmn2r109 T C 17: 20,540,520 I858M probably benign Het
Vmn2r71 A T 7: 85,623,661 Q561L possibly damaging Het
Yme1l1 A G 2: 23,181,065 D271G probably damaging Het
Zfp629 A G 7: 127,611,995 F214S probably damaging Het
Zfp709 A G 8: 71,889,464 I246V probably benign Het
Other mutations in Klk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Klk8 APN 7 43803689 missense probably benign 0.14
R0783:Klk8 UTSW 7 43802197 missense probably damaging 1.00
R1733:Klk8 UTSW 7 43802121 missense possibly damaging 0.94
R2020:Klk8 UTSW 7 43799216 missense probably benign
R4036:Klk8 UTSW 7 43798087 missense probably null 0.00
R5648:Klk8 UTSW 7 43798644 missense possibly damaging 0.95
R6237:Klk8 UTSW 7 43798670 nonsense probably null
R7609:Klk8 UTSW 7 43802179 missense probably damaging 1.00
Z1176:Klk8 UTSW 7 43803725 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCTCAGTCTATCCAGCATCC -3'
(R):5'- GCATGTATTCTGGGGCATGC -3'

Sequencing Primer
(F):5'- GCATCCTTGCTACAACAACAG -3'
(R):5'- TGGTTGACTGACAAACCCTG -3'
Posted On2020-06-08