Incidental Mutation 'R7848:Frmd4a'
ID628674
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 4591917 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably benign
Transcript: ENSMUST00000075767
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091497
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175944
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176828
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176864
AA Change: T150A
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657
AA Change: T150A

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177457
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACTCATTCATGCTGTGG -3'
(R):5'- TCTGTGACTGCAGGCCTAAG -3'

Sequencing Primer
(F):5'- GACACAGCCTAGCACGTTAGTTATTC -3'
(R):5'- ATCTTCCCACTGACCTGA -3'
Posted On2020-06-09