Incidental Mutation 'R7848:Gstm7'
ID628675
Institutional Source Beutler Lab
Gene Symbol Gstm7
Ensembl Gene ENSMUSG00000004035
Gene Nameglutathione S-transferase, mu 7
SynonymsCd203c, 0610005A07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R7848 (G1)
Quality Score103.008
Status Validated
Chromosome3
Chromosomal Location107926334-107931817 bp(-) (GRCm38)
Type of Mutationintron (284 bp from exon)
DNA Base Change (assembly) A to T at 107928586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004137] [ENSMUST00000106687] [ENSMUST00000106688] [ENSMUST00000124215] [ENSMUST00000133947]
Predicted Effect probably null
Transcript: ENSMUST00000004137
SMART Domains Protein: ENSMUSP00000004137
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.2e-23 PFAM
Pfam:GST_C_3 42 190 1.2e-9 PFAM
Pfam:GST_C 104 191 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106687
SMART Domains Protein: ENSMUSP00000102298
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.8e-24 PFAM
Pfam:GST_N_3 11 93 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106688
SMART Domains Protein: ENSMUSP00000102299
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N_3 4 89 8.8e-7 PFAM
Pfam:GST_N 5 78 4.2e-19 PFAM
Pfam:GST_C 100 188 5.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124215
SMART Domains Protein: ENSMUSP00000118707
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
Pfam:GST_N 1 72 8.6e-20 PFAM
Pfam:GST_N_3 3 83 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133947
SMART Domains Protein: ENSMUSP00000122567
Gene: ENSMUSG00000004035

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GST_N 45 123 2.6e-19 PFAM
Pfam:GST_N_3 54 134 1.4e-6 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Gstm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Gstm7 APN 3 107930278 missense possibly damaging 0.93
PIT4142001:Gstm7 UTSW 3 107931483 frame shift probably null
R0095:Gstm7 UTSW 3 107930563 splice site probably benign
R0961:Gstm7 UTSW 3 107926986 unclassified probably benign
R1052:Gstm7 UTSW 3 107926950 missense probably benign 0.05
R2121:Gstm7 UTSW 3 107926914 missense probably benign 0.00
R4610:Gstm7 UTSW 3 107926919 missense possibly damaging 0.65
R5966:Gstm7 UTSW 3 107931431 intron probably benign
R6393:Gstm7 UTSW 3 107930826 critical splice donor site probably null
R7014:Gstm7 UTSW 3 107926962 missense probably benign 0.00
R7052:Gstm7 UTSW 3 107931317 missense probably damaging 0.96
R7741:Gstm7 UTSW 3 107931647 missense possibly damaging 0.90
R7998:Gstm7 UTSW 3 107930341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATTGTCTACACGCGGC -3'
(R):5'- GCTTAAAATCAGCAAAAGCCAGTAG -3'

Sequencing Primer
(F):5'- TACACGCGGCTATTTCACAC -3'
(R):5'- AGCATGTACTGAGTGCTTGC -3'
Posted On2020-06-09