Mutagenetix > Incidental Mutation

Incidental Mutation 'R7886:Olfr847'

628699

Institutional Source

Beutler Lab

Gene Symbol

Olfr847

Ensembl Gene

ENSMUSG00000059821

Gene Name

olfactory receptor 847

Synonyms

MOR149-2, GA_x6K02T2PVTD-13113073-13112135

MMRRC Submission

045938-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R7886 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19373668-19378669 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 19375906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]

AlphaFold

Q8VFF4

Predicted Effect

probably benign
Transcript: ENSMUST00000079620

SMART Domains

Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.9e-56	PFAM
Pfam:7tm_1	41	290	2.1e-22	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000216839

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	G	6: 92,834,456	I130S	unknown	Het
Ano5	A	G	7: 51,570,393	H427R	probably benign	Het
Atad2	A	T	15: 58,126,136	V182E	probably damaging	Het
B4galnt1	T	C	10: 127,167,054	Y147H	probably damaging	Het
C1s2	T	C	6: 124,628,330	S349G	possibly damaging	Het
Ccdc51	G	T	9: 109,091,587	A181S	probably damaging	Het
Dcc	G	A	18: 71,954,868	Q100*	probably null	Het
Dchs2	A	T	3: 83,305,085	I2064F	probably damaging	Het
Depdc1a	G	A	3: 159,516,069	V217I	probably benign	Het
Dnajc7	A	T	11: 100,601,803	F31I	probably benign	Het
Eftud2	C	T	11: 102,840,108	R825H	probably damaging	Het
Fam184a	T	C	10: 53,675,160	E237G	probably damaging	Het
Fdx1l	A	T	9: 21,073,327		probably null	Het
Frem1	T	C	4: 83,016,406	D106G	possibly damaging	Het
Gabrg3	G	A	7: 56,724,481	R446W	probably damaging	Het
Gm42669	A	G	5: 107,508,706	E362G		Het
Hmcn1	A	T	1: 150,657,470	I3022N	possibly damaging	Het
Ifna2	C	A	4: 88,683,269	V171F	probably damaging	Het
Igsf10	T	C	3: 59,328,327	N1478D	probably benign	Het
Kcnc1	C	A	7: 46,427,621	D282E	probably damaging	Het
Klhdc2	G	A	12: 69,304,632		probably null	Het
Macrod2	G	A	2: 141,724,645	G188S	probably damaging	Het
Mapkbp1	T	C	2: 120,012,647	F186L	possibly damaging	Het
Mettl21a	T	C	1: 64,615,184	E58G	probably damaging	Het
Muc16	A	T	9: 18,585,982	C6625S	probably benign	Het
Naip5	A	T	13: 100,246,181	S7T	probably benign	Het
Nfs1	T	A	2: 156,142,061	D132V	unknown	Het
Nlgn1	T	C	3: 25,435,907	D552G	probably damaging	Het
Numa1	C	T	7: 102,013,865	T2066I	probably benign	Het
Olfr1355	A	G	10: 78,879,823	Y217C	possibly damaging	Het
Olfr330	C	A	11: 58,529,054	V311L	probably benign	Het
Olfr370	T	C	8: 83,541,947	S268P	possibly damaging	Het
Olfr730	A	T	14: 50,186,564	Y219N	probably damaging	Het
Pde11a	C	T	2: 76,291,203	V345I	probably benign	Het
Pglyrp2	A	G	17: 32,418,761	S98P	possibly damaging	Het
Pik3c3	C	T	18: 30,319,588	Q643*	probably null	Het
Pold2	T	C	11: 5,872,714	Y402C	probably damaging	Het
Pom121	T	C	5: 135,381,994	T770A	unknown	Het
Pou4f1	A	T	14: 104,466,792	V68E	probably damaging	Het
Ppfia1	G	T	7: 144,519,283	Q265K	probably benign	Het
Pygl	A	G	12: 70,206,356		probably null	Het
Rdh19	A	G	10: 127,850,300	T94A	probably benign	Het
Scgb1b12	A	G	7: 32,334,497	T61A	probably damaging	Het
Sirpb1c	C	T	3: 15,832,202	A337T	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,383	E381G	possibly damaging	Het
Tnik	A	G	3: 28,666,139	I1304V	probably damaging	Het
Tpmt	C	A	13: 47,040,162	G54C	probably damaging	Het
Usp25	A	T	16: 77,113,771	Q905L	probably damaging	Het
Vmn1r91	T	A	7: 20,101,565	N136K	probably benign	Het
Wdr70	C	T	15: 8,079,249	E138K	probably benign	Het
Wrb	T	A	16: 96,145,568	L31Q	possibly damaging	Het
Zbed3	A	G	13: 95,336,125	D19G	possibly damaging	Het
Zfp369	A	G	13: 65,292,054	K184R	possibly damaging	Het

Other mutations in Olfr847

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01150:Olfr847	APN	9	19375239	missense	probably damaging	1.00
IGL01293:Olfr847	APN	9	19375336	missense	probably benign	0.23
IGL01879:Olfr847	APN	9	19375407	nonsense	probably null
IGL03298:Olfr847	APN	9	19375062	missense	probably damaging	1.00
R1350:Olfr847	UTSW	9	19375414	missense	possibly damaging	0.94
R1400:Olfr847	UTSW	9	19375062	missense	probably damaging	0.98
R2894:Olfr847	UTSW	9	19375292	nonsense	probably null
R4468:Olfr847	UTSW	9	19375648	missense	probably benign	0.00
R4694:Olfr847	UTSW	9	19375398	missense	probably damaging	1.00
R4791:Olfr847	UTSW	9	19375809	missense	probably benign	0.28
R4794:Olfr847	UTSW	9	19375545	missense	probably benign	0.00
R5517:Olfr847	UTSW	9	19375767	missense	probably damaging	1.00
R5599:Olfr847	UTSW	9	19375629	missense	possibly damaging	0.77
R5777:Olfr847	UTSW	9	19375718	missense	probably benign	0.29
R6505:Olfr847	UTSW	9	19374941	makesense	probably null
R6509:Olfr847	UTSW	9	19375143	missense	probably benign
R7246:Olfr847	UTSW	9	19375465	nonsense	probably null
R7659:Olfr847	UTSW	9	19375558	missense	probably benign	0.03
R7789:Olfr847	UTSW	9	19375065	missense	probably benign	0.33
R8948:Olfr847	UTSW	9	19374966	missense	probably benign	0.03
R9326:Olfr847	UTSW	9	19375050	missense	probably damaging	1.00
R9612:Olfr847	UTSW	9	19375381	missense	possibly damaging	0.69
R9784:Olfr847	UTSW	9	19375820	missense	probably damaging	0.99
R9798:Olfr847	UTSW	9	19375281	missense	probably benign	0.30
Z1088:Olfr847	UTSW	9	19375684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGACAGCAATGATGATGAGC -3'
(R):5'- TGTATGTTGATGCACATGAATGTCC -3'

Sequencing Primer
(F):5'- CAGCAATGATGATGAGCAAATTTCCC -3'
(R):5'- CATGAATGTCCCCATTCAAATATA -3'

Posted On

2020-06-10