Incidental Mutation 'R7824:Bub1b'
ID628739
Institutional Source Beutler Lab
Gene Symbol Bub1b
Ensembl Gene ENSMUSG00000040084
Gene NameBUB1B, mitotic checkpoint serine/threonine kinase
SynonymsBUBR1
MMRRC Submission
Accession Numbers

NM_009773; MGI: 1333889

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118598211-118641591 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to G at 118626967 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038341] [ENSMUST00000038341]
Predicted Effect probably null
Transcript: ENSMUST00000038341
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038341
SMART Domains Protein: ENSMUSP00000037126
Gene: ENSMUSG00000040084

DomainStartEndE-ValueType
PDB:4GGD|D 14 35 6e-6 PDB
Mad3_BUB1_I 49 173 1.83e-68 SMART
low complexity region 198 214 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
coiled coil region 418 457 N/A INTRINSIC
low complexity region 671 686 N/A INTRINSIC
low complexity region 717 726 N/A INTRINSIC
Pfam:Pkinase 806 942 4.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant embryos undergo extensive apoptosis and die during early gestation. Heterozygous mice are viable and exhibit splenomegaly, abnormal megakaryopoiesis, and an increased susceptibility to intestinal tumorigenesis. Hypomorphic homozygotes display infertility and premature aging. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Mfge8 G T 7: 79,145,387 probably null Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Mybpc2 G A 7: 44,504,860 probably null Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Speg T A 1: 75,384,017 probably null Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Bub1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Bub1b APN 2 118630138 missense probably benign
IGL01319:Bub1b APN 2 118614994 missense possibly damaging 0.49
IGL01744:Bub1b APN 2 118636749 missense probably damaging 0.99
IGL03184:Bub1b APN 2 118609777 splice site probably benign
P0035:Bub1b UTSW 2 118622185 missense probably damaging 1.00
R0315:Bub1b UTSW 2 118626976 splice site probably benign
R0322:Bub1b UTSW 2 118639618 splice site probably benign
R0378:Bub1b UTSW 2 118641123 missense probably benign 0.01
R0457:Bub1b UTSW 2 118609859 missense probably damaging 1.00
R0845:Bub1b UTSW 2 118609976 missense probably damaging 1.00
R0960:Bub1b UTSW 2 118606680 missense probably benign 0.03
R1071:Bub1b UTSW 2 118632447 frame shift probably null
R1129:Bub1b UTSW 2 118615006 missense probably damaging 1.00
R1138:Bub1b UTSW 2 118623089 missense probably benign 0.01
R1171:Bub1b UTSW 2 118606686 missense probably benign 0.31
R1613:Bub1b UTSW 2 118639741 critical splice donor site probably null
R1667:Bub1b UTSW 2 118641189 missense probably benign 0.00
R1812:Bub1b UTSW 2 118632421 missense probably benign 0.00
R1828:Bub1b UTSW 2 118638439 missense probably benign 0.00
R2085:Bub1b UTSW 2 118622195 missense possibly damaging 0.88
R2137:Bub1b UTSW 2 118636718 nonsense probably null
R3749:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R3750:Bub1b UTSW 2 118615455 missense possibly damaging 0.63
R4211:Bub1b UTSW 2 118630978 missense possibly damaging 0.78
R4579:Bub1b UTSW 2 118623176 nonsense probably null
R4993:Bub1b UTSW 2 118636770 missense possibly damaging 0.63
R5144:Bub1b UTSW 2 118615499 missense possibly damaging 0.92
R5229:Bub1b UTSW 2 118629989 missense probably damaging 1.00
R5596:Bub1b UTSW 2 118630982 missense probably damaging 1.00
R5656:Bub1b UTSW 2 118605431 missense probably damaging 1.00
R5785:Bub1b UTSW 2 118609844 missense probably damaging 0.98
R5883:Bub1b UTSW 2 118609882 missense probably damaging 1.00
R6128:Bub1b UTSW 2 118617812 missense probably benign
R6187:Bub1b UTSW 2 118631000 missense probably damaging 1.00
R6333:Bub1b UTSW 2 118598463 critical splice donor site probably null
R6985:Bub1b UTSW 2 118606614 missense probably damaging 1.00
R6988:Bub1b UTSW 2 118636830 missense probably damaging 0.96
R7161:Bub1b UTSW 2 118626053 missense probably damaging 1.00
R7341:Bub1b UTSW 2 118636786 missense possibly damaging 0.95
R7575:Bub1b UTSW 2 118641158 missense possibly damaging 0.51
R8129:Bub1b UTSW 2 118638494 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAGTATCTTAGACTTGTGAGTGAG -3'
(R):5'- TCAGGGAAAGTCATGCAATGGTC -3'

Sequencing Primer
(F):5'- TCATGAGTTCAAGGCTGACC -3'
(R):5'- CATGCAATGGTCAGAGTCAGTTTTC -3'
Posted On2020-06-18