Incidental Mutation 'R7824:Mybpc2'
ID628740
Institutional Source Beutler Lab
Gene Symbol Mybpc2
Ensembl Gene ENSMUSG00000038670
Gene Namemyosin binding protein C, fast-type
SynonymsFast-type C-protein
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7824 (G1)
Quality Score159.009
Status Validated
Chromosome7
Chromosomal Location44501699-44524656 bp(-) (GRCm38)
Type of Mutationintron (139 bp from exon)
DNA Base Change (assembly) G to A at 44504860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000206398]
PDB Structure
Solution structure of the fibronectin type-III domain of mouse myosin-binding protein C, Fast-type homolog [SOLUTION NMR]
Solution structure of the Ig-like domain(433- 525) of murine myosin-binding protein C, fast-type [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Predicted Effect probably benign
Transcript: ENSMUST00000207516
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. This family includes the fast-, slow- and cardiac-type isoforms, each of which is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The protein encoded by this locus is referred to as the fast-type isoform. Mutations in the related but distinct genes encoding the slow-type and cardiac-type isoforms have been associated with distal arthrogryposis, type 1 and hypertrophic cardiomyopathy, respectively. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Bub1b T G 2: 118,626,967 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Mfge8 G T 7: 79,145,387 probably null Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Speg T A 1: 75,384,017 probably null Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Mybpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Mybpc2 APN 7 44505405 unclassified probably benign
IGL00586:Mybpc2 APN 7 44505382 missense probably damaging 0.96
IGL00976:Mybpc2 APN 7 44522317 splice site probably null
IGL01099:Mybpc2 APN 7 44516167 missense probably damaging 0.99
IGL01348:Mybpc2 APN 7 44515928 missense probably benign
IGL01625:Mybpc2 APN 7 44516913 missense possibly damaging 0.65
IGL01733:Mybpc2 APN 7 44506198 missense probably benign 0.03
IGL01946:Mybpc2 APN 7 44509898 unclassified probably benign
IGL02078:Mybpc2 APN 7 44503780 missense probably damaging 1.00
IGL02314:Mybpc2 APN 7 44522388 missense possibly damaging 0.82
IGL02341:Mybpc2 APN 7 44514930 missense probably benign 0.00
IGL02904:Mybpc2 APN 7 44522341 missense probably benign 0.05
IGL03034:Mybpc2 APN 7 44511897 missense possibly damaging 0.87
IGL03296:Mybpc2 APN 7 44506884 missense probably damaging 1.00
R0094:Mybpc2 UTSW 7 44516904 missense probably damaging 1.00
R0329:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0330:Mybpc2 UTSW 7 44509029 missense possibly damaging 0.94
R0336:Mybpc2 UTSW 7 44505616 missense probably damaging 1.00
R0503:Mybpc2 UTSW 7 44512570 unclassified probably benign
R0821:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0822:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0823:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0854:Mybpc2 UTSW 7 44517002 missense probably benign 0.06
R0938:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0939:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0940:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R0941:Mybpc2 UTSW 7 44506887 missense probably benign 0.02
R1166:Mybpc2 UTSW 7 44505025 missense possibly damaging 0.84
R1219:Mybpc2 UTSW 7 44516034 splice site probably null
R1559:Mybpc2 UTSW 7 44513687 missense probably benign 0.01
R1732:Mybpc2 UTSW 7 44513675 missense probably benign
R1802:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
R2157:Mybpc2 UTSW 7 44509845 missense possibly damaging 0.93
R2216:Mybpc2 UTSW 7 44512500 unclassified probably null
R2406:Mybpc2 UTSW 7 44521725 missense possibly damaging 0.62
R2411:Mybpc2 UTSW 7 44506238 missense probably damaging 1.00
R3079:Mybpc2 UTSW 7 44506081 missense probably damaging 1.00
R4663:Mybpc2 UTSW 7 44505642 missense probably damaging 0.99
R4736:Mybpc2 UTSW 7 44512547 missense probably damaging 1.00
R5316:Mybpc2 UTSW 7 44520382 nonsense probably null
R5426:Mybpc2 UTSW 7 44509829 missense probably benign 0.01
R5498:Mybpc2 UTSW 7 44516265 missense probably damaging 1.00
R5539:Mybpc2 UTSW 7 44514893 missense probably benign 0.17
R5644:Mybpc2 UTSW 7 44507053 missense probably benign 0.13
R5909:Mybpc2 UTSW 7 44507091 missense probably damaging 1.00
R6435:Mybpc2 UTSW 7 44506057 missense possibly damaging 0.73
R6662:Mybpc2 UTSW 7 44506166 missense probably benign
R6901:Mybpc2 UTSW 7 44505355 missense probably damaging 0.99
R7188:Mybpc2 UTSW 7 44506193 missense probably benign 0.06
R7389:Mybpc2 UTSW 7 44505604 missense probably benign 0.11
R7405:Mybpc2 UTSW 7 44507194 missense probably damaging 1.00
R7553:Mybpc2 UTSW 7 44506147 missense possibly damaging 0.51
R7597:Mybpc2 UTSW 7 44509799 missense probably damaging 1.00
R7772:Mybpc2 UTSW 7 44515924 critical splice donor site probably null
R8003:Mybpc2 UTSW 7 44509064 missense probably damaging 0.99
R8179:Mybpc2 UTSW 7 44509830 missense probably benign 0.01
R8187:Mybpc2 UTSW 7 44512470 missense possibly damaging 0.81
X0052:Mybpc2 UTSW 7 44507142 missense probably benign 0.23
X0065:Mybpc2 UTSW 7 44505385 missense probably benign 0.01
Z1088:Mybpc2 UTSW 7 44516503 missense possibly damaging 0.47
Z1176:Mybpc2 UTSW 7 44521696 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCATAGGGTTAAGTGACATG -3'
(R):5'- TCTCAACTGTGCCGTCAGAG -3'

Sequencing Primer
(F):5'- TTGAGTTCAAGGCCATCCTAGAC -3'
(R):5'- TCAGAGGCCACCCTAAGG -3'
Posted On2020-06-18