Incidental Mutation 'R7833:Mybbp1a'
ID 628747
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene Name MYB binding protein (P160) 1a
Synonyms p67MBP, p160MBP
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72332181-72342594 bp(+) (GRCm39)
Type of Mutation splice site (48 bp from exon)
DNA Base Change (assembly) A to G at 72333727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633] [ENSMUST00000076443] [ENSMUST00000100903]
AlphaFold Q7TPV4
Predicted Effect probably null
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076443
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100903
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72,334,393 (GRCm39) missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72,336,492 (GRCm39) missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72,334,744 (GRCm39) splice site probably benign
IGL03344:Mybbp1a APN 11 72,336,028 (GRCm39) missense probably damaging 1.00
fratelli UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
primi UTSW 11 72,333,727 (GRCm39) splice site probably null
sorelli UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72,340,933 (GRCm39) splice site probably null
R0437:Mybbp1a UTSW 11 72,339,674 (GRCm39) missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72,339,202 (GRCm39) missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72,334,474 (GRCm39) missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72,336,043 (GRCm39) missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72,336,863 (GRCm39) missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72,332,271 (GRCm39) missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72,337,021 (GRCm39) missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72,339,563 (GRCm39) missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72,337,996 (GRCm39) missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72,342,113 (GRCm39) missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72,336,538 (GRCm39) missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72,338,797 (GRCm39) missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72,336,466 (GRCm39) missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72,336,040 (GRCm39) missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72,338,939 (GRCm39) missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72,341,462 (GRCm39) missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72,336,998 (GRCm39) missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72,335,751 (GRCm39) missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72,333,257 (GRCm39) missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72,336,838 (GRCm39) missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72,338,392 (GRCm39) missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72,338,468 (GRCm39) splice site probably null
R7227:Mybbp1a UTSW 11 72,338,585 (GRCm39) missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72,334,338 (GRCm39) missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72,342,101 (GRCm39) missense probably benign 0.01
R8213:Mybbp1a UTSW 11 72,335,547 (GRCm39) missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72,336,114 (GRCm39) critical splice donor site probably null
R8474:Mybbp1a UTSW 11 72,338,563 (GRCm39) missense probably benign 0.01
R8972:Mybbp1a UTSW 11 72,337,076 (GRCm39) missense probably benign 0.35
R9018:Mybbp1a UTSW 11 72,334,420 (GRCm39) missense probably benign 0.09
R9380:Mybbp1a UTSW 11 72,333,668 (GRCm39) missense probably benign 0.24
R9505:Mybbp1a UTSW 11 72,339,897 (GRCm39) missense probably benign 0.26
X0050:Mybbp1a UTSW 11 72,332,503 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGCTCTCTGTGGATACCAGG -3'
(R):5'- AGGCATTGACAAGCACTGTTC -3'

Sequencing Primer
(F):5'- CTCTCTGTGGATACCAGGACAAAG -3'
(R):5'- TTGACAAGCACTGTTCCAGAC -3'
Posted On 2020-06-18