Incidental Mutation 'R7820:Pou4f2'
ID628752
Institutional Source Beutler Lab
Gene Symbol Pou4f2
Ensembl Gene ENSMUSG00000031688
Gene NamePOU domain, class 4, transcription factor 2
SynonymsPou4f-rs1, Brn-3.2, Brn3b, mBrn3-3R, Brn-3b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7820 (G1)
Quality Score55.0072
Status Validated
Chromosome8
Chromosomal Location78433010-78436645 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 78436502 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034115]
Predicted Effect probably benign
Transcript: ENSMUST00000034115
SMART Domains Protein: ENSMUSP00000034115
Gene: ENSMUSG00000031688

DomainStartEndE-ValueType
low complexity region 31 86 N/A INTRINSIC
low complexity region 109 118 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
POU 252 329 1.33e-51 SMART
HOX 347 409 3.31e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice have a 70% reduction in retinal ganglion cells, a thin retina, and an optic nerve with a decreased diameter and disorganized axons. Eyes have miotic pupils and defective optokinetic reflexes that prevent photo-entrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Pou4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Pou4f2 APN 8 78435105 missense probably damaging 0.99
IGL01578:Pou4f2 APN 8 78435655 missense probably damaging 1.00
IGL02750:Pou4f2 APN 8 78435063 missense probably damaging 1.00
R0538:Pou4f2 UTSW 8 78435662 missense probably damaging 1.00
R0597:Pou4f2 UTSW 8 78435240 missense probably benign 0.00
R1328:Pou4f2 UTSW 8 78436130 missense probably benign 0.01
R1680:Pou4f2 UTSW 8 78434831 missense probably damaging 1.00
R2376:Pou4f2 UTSW 8 78436185 missense unknown
R3980:Pou4f2 UTSW 8 78435438 missense possibly damaging 0.88
R4770:Pou4f2 UTSW 8 78436401 missense unknown
R4771:Pou4f2 UTSW 8 78435236 missense possibly damaging 0.67
R5288:Pou4f2 UTSW 8 78436329 missense unknown
R5395:Pou4f2 UTSW 8 78435072 missense probably damaging 1.00
R5930:Pou4f2 UTSW 8 78436391 missense unknown
R6036:Pou4f2 UTSW 8 78435474 missense probably damaging 0.96
R6036:Pou4f2 UTSW 8 78435474 missense probably damaging 0.96
R6883:Pou4f2 UTSW 8 78435678 missense probably benign 0.01
R7300:Pou4f2 UTSW 8 78436106 splice site probably null
Z1088:Pou4f2 UTSW 8 78435601 missense probably benign 0.00
Z1177:Pou4f2 UTSW 8 78435180 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGAAGACAAGCTCTCCG -3'
(R):5'- TATAACTCCACCGCCTCGATG -3'

Sequencing Primer
(F):5'- ACTGTGTAGCGCCGAGTAC -3'
(R):5'- TCGATGAGCTGGGGCAC -3'
Posted On2020-06-19