Incidental Mutation 'R7820:Samd3'
ID628753
Institutional Source Beutler Lab
Gene Symbol Samd3
Ensembl Gene ENSMUSG00000051354
Gene Namesterile alpha motif domain containing 3
SynonymsLOC268288
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26229707-26272172 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 26233518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060716] [ENSMUST00000164660] [ENSMUST00000218301] [ENSMUST00000220219]
Predicted Effect probably null
Transcript: ENSMUST00000060716
SMART Domains Protein: ENSMUSP00000057805
Gene: ENSMUSG00000051354

DomainStartEndE-ValueType
SAM 1 66 3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164660
SMART Domains Protein: ENSMUSP00000129054
Gene: ENSMUSG00000051354

DomainStartEndE-ValueType
SAM 1 66 3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218301
Predicted Effect probably null
Transcript: ENSMUST00000220219
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Samd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Samd3 APN 10 26251846 missense probably damaging 1.00
IGL00754:Samd3 APN 10 26244527 missense probably benign 0.19
IGL01672:Samd3 APN 10 26270169 missense possibly damaging 0.94
IGL02211:Samd3 APN 10 26233557 missense probably damaging 1.00
IGL02397:Samd3 APN 10 26233576 missense possibly damaging 0.85
IGL02755:Samd3 APN 10 26244577 missense probably damaging 1.00
IGL02885:Samd3 APN 10 26271864 missense probably benign 0.43
IGL03115:Samd3 APN 10 26271708 missense probably damaging 1.00
IGL03157:Samd3 APN 10 26263842 missense probably benign 0.05
IGL03172:Samd3 APN 10 26230166 missense probably damaging 1.00
BB006:Samd3 UTSW 10 26251915 missense probably damaging 1.00
BB016:Samd3 UTSW 10 26251915 missense probably damaging 1.00
R0034:Samd3 UTSW 10 26271500 splice site probably benign
R0081:Samd3 UTSW 10 26271501 splice site probably benign
R0197:Samd3 UTSW 10 26271854 missense possibly damaging 0.77
R0566:Samd3 UTSW 10 26244498 missense possibly damaging 0.83
R0632:Samd3 UTSW 10 26244495 missense possibly damaging 0.86
R0782:Samd3 UTSW 10 26270240 missense probably damaging 0.97
R0834:Samd3 UTSW 10 26271827 missense probably benign 0.01
R1106:Samd3 UTSW 10 26271791 missense possibly damaging 0.57
R1844:Samd3 UTSW 10 26251774 missense probably damaging 1.00
R1907:Samd3 UTSW 10 26271856 nonsense probably null
R1929:Samd3 UTSW 10 26263986 splice site probably benign
R2925:Samd3 UTSW 10 26251887 missense probably benign 0.37
R5104:Samd3 UTSW 10 26263788 missense possibly damaging 0.61
R5736:Samd3 UTSW 10 26270172 missense probably damaging 1.00
R7120:Samd3 UTSW 10 26230966 missense possibly damaging 0.77
R7437:Samd3 UTSW 10 26270106 missense possibly damaging 0.78
R7510:Samd3 UTSW 10 26230108 missense probably benign
R7599:Samd3 UTSW 10 26263813 missense probably benign 0.00
R7801:Samd3 UTSW 10 26263872 missense possibly damaging 0.57
R7806:Samd3 UTSW 10 26244527 missense probably benign 0.19
R7929:Samd3 UTSW 10 26251915 missense probably damaging 1.00
R8298:Samd3 UTSW 10 26245570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCAGCCTCATTGTGTG -3'
(R):5'- AGCATCTCCATCACTTGATAGAAG -3'

Sequencing Primer
(F):5'- TGAGGTGAGGCACAGGATCTTC -3'
(R):5'- TCCATCACTTGATAGAAGCTTACC -3'
Posted On2020-06-19