Incidental Mutation 'R7820:Rgs11'
ID628754
Institutional Source Beutler Lab
Gene Symbol Rgs11
Ensembl Gene ENSMUSG00000024186
Gene Nameregulator of G-protein signaling 11
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26202951-26211324 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 26205195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000025020] [ENSMUST00000121959] [ENSMUST00000122058] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Rgs11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Rgs11 APN 17 26207397 missense probably damaging 1.00
IGL01617:Rgs11 APN 17 26208250 missense probably damaging 1.00
IGL02150:Rgs11 APN 17 26202994 missense probably benign 0.05
IGL02610:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02612:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02617:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02669:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02670:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02674:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02706:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02707:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02741:Rgs11 APN 17 26207631 missense probably benign 0.31
R0147:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0148:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0508:Rgs11 UTSW 17 26207469 splice site probably benign
R0744:Rgs11 UTSW 17 26203318 missense probably damaging 1.00
R1479:Rgs11 UTSW 17 26208283 unclassified probably null
R1599:Rgs11 UTSW 17 26208249 missense probably damaging 1.00
R1779:Rgs11 UTSW 17 26210666 missense probably damaging 1.00
R3692:Rgs11 UTSW 17 26204328 unclassified probably benign
R3807:Rgs11 UTSW 17 26203500 missense probably damaging 0.99
R3889:Rgs11 UTSW 17 26207587 missense probably damaging 0.98
R4689:Rgs11 UTSW 17 26204547 critical splice donor site probably null
R4832:Rgs11 UTSW 17 26207568 missense probably benign 0.00
R5052:Rgs11 UTSW 17 26207973 intron probably benign
R5330:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5331:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5683:Rgs11 UTSW 17 26205181 missense probably benign 0.32
R5879:Rgs11 UTSW 17 26203463 unclassified probably benign
R6156:Rgs11 UTSW 17 26210465 nonsense probably null
R6671:Rgs11 UTSW 17 26208298 missense probably damaging 1.00
R7432:Rgs11 UTSW 17 26207760 missense probably damaging 0.99
R7609:Rgs11 UTSW 17 26207441 missense probably damaging 1.00
R7795:Rgs11 UTSW 17 26207578 missense possibly damaging 0.88
R8025:Rgs11 UTSW 17 26204385 critical splice donor site probably null
Z1088:Rgs11 UTSW 17 26205772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGACCAAGAACATGACGTC -3'
(R):5'- TCCCTTAGACAGAGTTAACCTGG -3'

Sequencing Primer
(F):5'- ATGACGTCACAGGTTCCACTG -3'
(R):5'- AGACAGAGTTAACCTGGCTTGTTC -3'
Posted On2020-06-19