Mutagenetix > Incidental Mutation

Incidental Mutation 'R7850:Tcaf3'

628763

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R7850 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 42594206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

probably null
Transcript: ENSMUST00000069023

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000069023

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,068,128	D2E	probably damaging	Het
Abhd16b	G	A	2: 181,493,725	R140H	not run	Het
Acad11	G	T	9: 104,114,529	G588C	probably damaging	Het
Baz2b	C	A	2: 59,936,716	E107D	probably damaging	Het
Bcas1	A	G	2: 170,348,103	S625P	probably damaging	Het
Bdp1	T	A	13: 100,092,324	L265F	probably damaging	Het
Cacna1s	A	G	1: 136,071,048	Y227C	probably damaging	Het
Cacna2d2	G	A	9: 107,525,376	A848T	probably benign	Het
Cep135	T	C	5: 76,591,873		probably null	Het
Cyp2b9	G	T	7: 26,186,686	E93*	probably null	Het
Dcp2	C	A	18: 44,400,348	S122*	probably null	Het
Ecel1	A	G	1: 87,152,023	L456P	probably damaging	Het
Entpd8	T	C	2: 25,085,016	M453T	probably damaging	Het
Gcc2	T	A	10: 58,278,881	V1084D	probably damaging	Het
Grem1	A	G	2: 113,749,833	C108R	probably damaging	Het
Gtf2ird1	T	C	5: 134,363,215	E880G	probably benign	Het
Hacd2	T	A	16: 35,102,107	M222K	probably damaging	Het
Htr1b	G	T	9: 81,632,599		probably null	Het
Htt	T	G	5: 34,852,287		probably null	Het
Ifnab	T	G	4: 88,690,896	D111A	probably benign	Het
Igsf10	A	T	3: 59,319,632	L2207I	probably benign	Het
Itln1	T	C	1: 171,530,598	Y194C	probably damaging	Het
Kmt5b	T	A	19: 3,815,043	D702E	probably damaging	Het
Knop1	T	C	7: 118,850,637	E382G	unknown	Het
Lrit3	A	C	3: 129,800,803	L42V	probably damaging	Het
Mug2	A	G	6: 122,075,211	E976G	probably damaging	Het
Olfr1436	T	C	19: 12,298,632	M167V	probably benign	Het
Olfr281	G	A	15: 98,457,068	G253R	probably damaging	Het
Olfr945	A	T	9: 39,258,222	I150N	possibly damaging	Het
Papln	A	T	12: 83,780,662	E758V	probably damaging	Het
Pcnx3	A	C	19: 5,678,932	F967V	possibly damaging	Het
Pcnx4	G	T	12: 72,556,068	C368F	probably benign	Het
Pi15	T	A	1: 17,602,881	Y101*	probably null	Het
Ppp1r9a	G	A	6: 4,905,894	V150M	possibly damaging	Het
Prrt4	A	T	6: 29,176,901		probably null	Het
Ptgdr	A	G	14: 44,853,371	V310A	probably benign	Het
Ric1	G	A	19: 29,594,893	S696N	probably benign	Het
Setx	T	A	2: 29,147,418	V1305D	probably damaging	Het
Slk	G	A	19: 47,622,357	R822H	probably damaging	Het
Tas2r135	T	A	6: 42,406,138	F204I	probably benign	Het
Tmtc2	A	G	10: 105,573,707	Y15H	probably benign	Het
Treml2	T	C	17: 48,308,140	S218P	probably benign	Het
Tubb2a	T	C	13: 34,074,571	E412G	probably damaging	Het
Usp48	T	G	4: 137,605,749		probably null	Het
Vmn2r25	A	T	6: 123,828,472	N475K	probably damaging	Het
Zscan4-ps1	G	A	7: 11,065,808	H385Y	probably benign	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCACAAATGGCAGCATAGTTTG -3'
(R):5'- ATAAGCCCACATACTGGCTCTG -3'

Sequencing Primer
(F):5'- GGCAGCATAGTTTGATTAAGTATGAG -3'
(R):5'- CTGGCTCTGATCAACTTTATCAATG -3'

Posted On

2020-06-22