Incidental Mutation 'R7850:Tcaf3'
ID 628763
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7850 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 42594206 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably null
Transcript: ENSMUST00000069023
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069023
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Htr1b G T 9: 81,632,599 probably null Het
Htt T G 5: 34,852,287 probably null Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Mug2 A G 6: 122,075,211 E976G probably damaging Het
Olfr1436 T C 19: 12,298,632 M167V probably benign Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Papln A T 12: 83,780,662 E758V probably damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Pi15 T A 1: 17,602,881 Y101* probably null Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tas2r135 T A 6: 42,406,138 F204I probably benign Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Usp48 T G 4: 137,605,749 probably null Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACAAATGGCAGCATAGTTTG -3'
(R):5'- ATAAGCCCACATACTGGCTCTG -3'

Sequencing Primer
(F):5'- GGCAGCATAGTTTGATTAAGTATGAG -3'
(R):5'- CTGGCTCTGATCAACTTTATCAATG -3'
Posted On 2020-06-22